Description :
From Genome Similarity Track
Location :
Scaffold_2321:2265- 3952
Transcript NameFunction/comments
Phypl_g14952hypothetical protein PHYSODRAFT_334566

Sequence
1687 bases(100 bases per row)
CTGCAAATAGCGAGCCACACAGCGGTCGCCATGAGCACGAGTATCAACACGCGAGCACTGACCGTTAATGCATGGATCGATCCACCTGAATTTAAAGGTC
ACTACTACTCTGTCCCACCAATTTATAGGTAGTTTGGTGTTTTGTGTACCACACGAAAACATTACAACGATCCTATTGGCTTATATTATCACGGTTATGA
AAAACGCTCGTCTACCGTAAAATGGTTGGCCTATAGCGTTAATTCACTGCAGCCATCAGATGCCACATAACGAAAAGAGCTGGGGATGGCGCGGACTGTG
GGAGCTAAGGACAtcgcgccagcagcgcgcgtcGCGGTGGTGTTCTTCCTTGCAACTCTAAGTAAGGAAGGCCGCCTCCGCTACGGCACAATTGTGCGAG
CGACAAGGGCGTTTGGACTCAGCCGTGCAGCCGTCGAGATCATCTGGGGTCTGCGCGTCGCGGCGGTGCCACTTTGTCAGCaccagacgctgcgcgcTTT
GGAGGCGGCTACAGAGACCCCAAtatcgacgctgcagcgtcacctcaaggccaaggtgctgcggcGCTTCATCTCAAGgatcaagctgcagctcaccgAC
GCACACAAGCACCAGCGGCTGACATGGGCACTTGCCCACGTGCAGCGCCCAATTGGTACGACTCAATTACTATTTTGATATTATATTGCTTGACATTATT
GTATTCTAATATTGGTTTTAGGCGGGCGTTCGTATCGTTTTGATGCCATGTATGATGTTGTTCACATAGATGAAACATGGTTTAACATGTACAAGGCGAC
ACTACTTGTCTGCTGATGAACCATTGCCTTACCGTTCGTGTCCTAACAAGCGCTATATCGGTAAGGTGATGTTTCTCGCAGCCGTAGCGAGACCGCGGTA
CAATTTTCCAAAAAGGACACACTTTGATGGAAAAATCGGAATATGGCCTATTGTTGAGTACGCTACGACAAAGAAAACGTCAAAGAACCGCGTTGCCGGT
ACCCCGATCACCAAGAACATTATATAACGAGAACAGTGTACGTCCGCTTGGTCAAGGAGAAGGTCTTTCCTGCTATTCGAGAAAAGTGGCCAGGTTCGTA
TTTTGTCAATTTGGTTGACTTGATTTCACTATGATCAACTGACATTTGACGTATTCAGGACGGAAAACTTCCACGATTTTTGTCCAGCAAGACAACGCCG
GCCCACACGTTGACGAAGACCACGGTGAGGGTAGTGCTGCCGGACAAGACGGTGGCTGGAATATCAAGATGACTTATCAGCCTCCCGTTCGCCCGACTGC
AATATTTGGGATTTGGGAATTTTCAACGCAATTCAATCCATAGAGTATCGACAGTCGACCAACCAGAGCGATGGGCTTATTGCCGCAATATGAACTGCAT
TTAACAGTGTTAAAAATCAAACGATAGAGAAATGCTTCCTCACTTTGCAAAAAGTGCTGGAATGCATCATCTCTAACTAGGGATGCAATGATTTTAAGCT
CCCTCGAGTTCGTAAGTTCGTCGGACCAAATGGAGTTTGTCCGACGGCATTAACGACGACAGCCTCAACAGTAGAGAATGGCTACAAAGCTCTGACTGCT
CAGATCCTTAATCAATAAACCCTTTTTCTGTGTTTCCTAAATCCTCGATTTAATTTTCTAAATCGTTGACTAAAACCGAGGTGGTAG