Description :
From Genome Similarity Track
Location :
Scaffold_84:22647- 26427
Transcript NameFunction/comments
Phypl_g2720hypothetical protein

Sequence
3780 bases(100 bases per row)
GTGATGTCGTGTCACGTAAATCTAGCAGTGACAAGCAGTGCTGTAGACTCAAGTTCAGGTACTTCAGCAAGGCAAACCGAAGCTGCAGTGACTCTAGTga
cagatccagcagctgcgagcACCTCAAGCCGTCTAGCGTTTGGTCCAGCTTAATGTCTGCTGGTTGCAGATCAACTGAACGTCTGATAGTTGCTGGCGTG
GCCGAGGGCAGTGACGCTGCAGGTTCCACGTGATTGTTCACCCAGTCCACCAGCTGCAAGTCCATGGCTTGAGTCCAGCGATCTCCTTCAGACGTGTCAT
CAGGGCTTGCTTGGTGCTGAACGATTTTCTGGAGAAGTTGTTCCATGTCTGTGACTGTCGCGCGAGATAATTGCTTTTCCTTAGGAATACCCAGAGCATT
AACAGTTGCCGCGAAGCCAAAGTGAGCACCAGCGTTTTCATCCGCATGGAACGAGTACTCGAGATTGTTGCCATCGTGAGAGATAGCACCCTCAGGCCAC
CCACTTTCCCCCGCATACGTTCGGTTACTGCGGATTTCCTTTACAGGCTCACCAGAGCCGTCTTCACGGGGAACAAGCATGAAGCTGGCCAGATCAAGTC
GCGACattccttggccttggcccGGTGCAAGGGAGCAGCGTGAGTCGAACGTTATCCGAAGAGCCTGAGCGTCTTCAAACCCAACGTGACCGCTTAAGGG
CGTACCAGGAGCGTACGGGTGCGAAGTTTCGATGACTGTAGAAGATCCGTAGACCTCCAGCCATATCGCGACCAAGACATGCTGCGACAGTCGGGCGGTT
TGTCCGAGCAAAAACCTAGAGAGTTCCGATATATCGTTGAGGCTATCACGGGCGCGCTTCCGTTCCAACGGTACAGGAAAATCGAAAGGTGCTGTTAGAA
GTGGTGCGGATGCAGCGCTGTCGCCTTTCATCTTTCGCTTGAAGACGGACGATGCAGATGATATCATCATCGACAGttccacgacctgcagcaAATGGGC
CGAGAGGAACACCTTGCCACTTGCTCTGTCGACCTCTGCACGGGTCAATGCCAACCGAGAAATTGATTCCAGCGCGTCCAGTTCGGGCACTTCATCTCCC
GGGAACAGCTCAGGGCGGTGCAATAGTTGCTGCAGTAAGCGTACCACGCGGCCCTTAAACGGAGCTCCAGGTGAGCGCAGATAACGCACAAGTGCACCAT
ATATTTTGCGATTGTGCACGGCTCCGTGTGCTACCAACTCCGTTGCATCGTTGAGCAACAGCTCCAATATCCAGCATGCCCACTCTAGCGAAGGACTTGC
CAGTACCTCCGACTCTTTTGTCCAACGAATATTAGCCATGGGCTTCACTTGGAAGCGATATCCATAACCGTTATCTTTCGTGGCATTCTCTTCCGAAGCC
GTAAAACGGAACCAGAACTGGTGTGAATGGATAATCAAATCCGGAAGATGACCAGACGTCGTCATTGCATTGTCCACCACGCCAACGCGGTCTTCACACT
CCGGGTCGGCAAAGAAGGTCAGCTTTCCCTTGGGCCCCAATCGACACCGATGGTCGAACACAATGCGCAAGCAGCGATACGAGCTATCGATGCTAACTGC
TCGAGCGTATTCGCATCGACCAAAGTATGGATGCAACGATTGGAACTCTTGGACAGCTAACGCCTCGCCTGCACCATCTCCTGCCATCCGCGTAGATTCC
ACAAAGTGAGTGACGCACTCTTGGACTAGCACACTTGATAGCAGGCCGTCATGGTCATCAACTCCACCACCTAAGTATGCGCTTGCAACTTCTTGTGCTT
CAGTATCGGACGGCTGGCGAGTACTTCTCATGTACCTGGAACTGCCTTCACTCTTGCTTTCATCATGTAACCAATCACCAAACTTTTCCTCTGTTGTCGC
AGGAGCAAGAGATGGCAGAGATTCTTCAATAGACAGTTCAATCGCCCGACTTAAAgcctcatcttcgtcatcatcttcacTGTACTCAGGAACTCCAGGG
ACCGAATGAGAAATTGTGTACTCGCCGCCAGACGCCGAACTACTTCCGTGCTGGTCACTTGAGGGGGCTCGTTTAGGGGAACCGATACGAGGCCGATACG
AATTTAATTCAGAATTCGCGAACTTTTCAGTTCGTGCTTCTTCACGGAGCATCCGCAACGTAATAGCCTGAAGACTGACCAACAAAGCTACTGGTTGCTC
GGTAATATCAGCAGTCGACTTGTCTCTTCCATCTGCCGTGCTTCTCGCCGTAGAAACACCCTTAGCTTCAACTTCCGTATGCTGGGTAGAATTCATTTCG
GAAGCAGCCACCATTTTAAGGAGACTTACAAACTGGCGCGGACCACCAAGCACACTTAGGATCTCGTTTGAAAAGGAAGACGACACCACCGGTGGCTTAT
CTTCAAGACCTTGACCCTCTTCAATGGCAATCCTTGCTGGCTCTGGAGTCGAACTTCCCACAGAATCGAAAGCGCAGAGCAAAGCTGTGATTGCACGCCT
GGCATAATGAGTGGAAAGCGCGTTTTCCGTTCTCAGAGCAACACGATGTATGCTTTCCACACCCTCCAGAGGCTCGTCGTAAATCCTTACAATCCGACGC
AAGTCTCGTGGAAAGTGCCACTCGTCTTCGTACGCGCCAGACTCTGTGTTCAGGAAGGTGATGAGCACACCATCGTCGGGTGAATAACTCCTGTAAGTAC
CTGTTCGGCCGCTGGTTGCTAAGCGCTGAACCGGGCCAATGTCGCTAGTCACTGTCAAGAGAACATTCGGGGTCAAATACTCCGGATCAAGTGGTGAGAA
GGCTGTCATACTAATATCTCGCGCTACAGCAGCACCCGACTTGGGCTTAACCGGCCCAGGGGCCAAGATGGGGGCAAGGGTCACGGCCATCGCATCAACA
TTGGGGAGGTGTAACAACTCTGCCCTTCGCGTTGAGGCAGCTGAACCCAAATACTCGGCAGCAATAGCGTCCTGGCGGCCGGAAGTCGTCACAAGGGGGT
CGGGCTGATCAATTTCTTCCATAGCAGCTCGGTCCTCCAGAACAACAGTTCTTGCAGCTGAGAAAGCGTCCGTTAACAAATCGAGAGAATCAAATTTCTC
TGCGTAGTTGCTGCCATGCTCCATCAACCACTCCATAGCACGGTTGGGGTCATTATTCGAGAGCTCCAGAGCGCAAACGGCAAGGCAAAAAGGCATCCCT
GAGATATTTTGAAGCTCTGTCGCCTTTGCTTCAAGTGTAAGACCGGGAGTTCCTTCTGCCCCTTCAGCTAACTCATGAGCCGCAATGCTTGCCCGTGCTa
ggcgctgcgcttcttgacgtTCCTGGTATGTTGCTGCTCCGTCACCCATCAGCCATTCTACCGCCAAATTAGGGTCGTCGCGAGCGTGTTCCAGTGCAGT
CATGCACAAGTCGAACTCAAAGCCCATCGCAGCCAAGGTCGACGCAAAACCTCTACGAACACGATGACTTTCTGTCTCTTCTTCCGCCGGGTCATCGTTG
ACTTCAATACCACCGGCACCAGTGGAATTCGTTGCTTCCGATgctgcaagtgctggcgctgttggcTCCTCCAACCCGTGAAACATTGCTTCGCCAAGTG
GCGTTGATGACTCTATCAGCCGGCACAAAATCATTCGACCCCTCTCCTGCAGCAATGGTAGGCTCAGAAAGCTGTTGAGACTGATCGGGGTCAAAGCAAA
CCGTAGAAGACTCTGCGTTAGGGTGTCATGCGCGAAACTTTTGGTCACATTAAGCGAGTGACGCAATAGGGCTTCCAGGG