Description :
From Genome Similarity Track
Location :
Scaffold_299:22646- 27523
Transcript NameFunction/comments
g16383.t1POM61164.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora
g16384.t1hypothetical protein

Sequence
4877 bases(100 bases per row)
TATCGGGTGGACTAAGAGATGCAACGTATGGTCCGTGAAAACTTGGGCAGGAAGCAAGACCGCAAGCATCAAATTCTTTGGTAGATGCCCTACCCAGCAC
AATTGTAGCTTTCCGTAGCTAAGCACCTCTCAACAGGAAACTTTGCCGATTTCGTGGCGATGAGATGGAATATGTAATACTTGGGTTTGATTTTATATTG
CGCGCTTTCATATCTCTGTTGAAGAGGATCACTAGTTCGTTTCTGAACCAGCCACGCCACCATTTGCAACCGGCTCTGGATCACTTCAGCTGCAAAAGTT
CTCGTCGGTCAGCTCCTCCATACTGGGGCTCTTGTCTATAGGAATGAGAAGCTCATCTACGCCATTTACATGTACGTTTAAATGTAAGTGTGGTGTATTT
TCCACCCTGGGATAGGAATACCAAGTGGTTCCTGACCCTATCAGGCTTTTCTGTGTAGTATTATATCCTGCGCCTTGCGGCTCGCTGACTTTTGTACCCG
GATACGATTTGATGTTCTAACCCATTTGGTTTCTGCTCGTGTTTTTAGTGCCTTAGCTACGCAGGTTATCGTGGGTATGCGCGTTAGACCGTGTGACATT
GTGATGTTCAAAGAGCTTAACAACCCACGAAATCAATTTGCTGGTACAGCACAGGATCTCCTCCTACCTGTGTCAATAGCGATTCGTTCATTGTTAACCA
TTTAGAATCTGCATTGAATTCGTTATGGTGCTACTAAAAATCGATGACTCGCTTGTGAAAGAGCATCACGAAGGAGCGTCCTTTACCCCGCCGTCGGGTA
ATTCTTCTGGAGCCAGGCGAAGTAGTCCCTGTAGAGCTGATAGAGCTTATCGTTGGTCTTGACACCCATTTTTTGAAACCTTTTGAAGACGGGGTCCGAG
TCCATCCCATTGGTTTTCCATTTCGCGAACAACTTTCCAGCGAAATCCTTGTCCTCCATCGCCCGATTGAGCCGCGTTGAGTCAAACAAAAAGTCTTTGG
CCAAAACCTTTTTTGACGATGCAGTGGGGTGGTGAATCTGGAGCCAGGCGAAGTAATCCGTGTAGAGCTTGTAGAGGATATTGTCCTTCTTGACACCCAG
TTGCTTAAACCTATCGAAGACGCCGTCCGAGTCGATTCCATTGCGTTTCCATCGCTGGAACAACGTGGTCGCGTACGTACCGTCGCCCATCGCCTTTTGG
AGCTTCACCCTGTCAAACATCTTCTTATCTCCCGTAACTATACCGAGTGGGTGATGTGTCTCGAGCCATGCGAGGTAATTCTTGTAGAGCTGGAAGACGT
TATCGTCCTTGTGAAGGTTATGCACTGTCAATTTCTTGAAAGCATCGTCACTTTCGAATCCGTAACGTTTCCACCTCCGGAACAACGTTTTCGCGTATTT
GGAGTCTGCTATCGCGAGCTTGATCTTCTCCGTGTTGAACATGTTGGCACCGGACAATCTCTCTTCGCTGTGGTCGTCTCCATCCGCTGTTTCGTGGACC
CGCAGGAACCTCTTCCCGTTGTTACGCCCCACATCCAGCAAGCCAGAGTCTGGGGACGCCATAGTGGAGACAATCATACCCTTGTCAGCACCCGCAGATA
ACGCGGTGCCCCTTGCAAGAAGAGTGAGCGCCGATACTACCGCAAGGAGAGATGGCAAGCGCATTGTAGATTCCTGGCACCGAAGAGAAAACCACTTATG
GACTGGAGGACGAACTACGGAATGGAAGTGGATGATGGGGTCGAACAGCAAAGTCATTTGAACGTCTGCTTTCGAAGCAAACCGTACATGGTACGCTCCG
AGCTTGCACGCAATTGCACTACATGTACTGACTGTATTATACTGTGCAAGGCCATGCACATTGCACTGCAACCTGCCGGGTGTGAGTCTACAAGCTCCGT
CGTGCGACACTTAGTGGCAAAAATCGTTCGGCTTTCACTACTTGCGCATTCCTTTCACTTGATTTTGGCCCTTATCCTGGGCTGGGATGATCTTGGGGTG
GGATAACCAGATGCCCTCAATTGGCCTCCACAATAATGGCCTTCTAGAGCCTTAGACGTGAGCGCACTGACATTCTAAGTGACCCGAAAGGGGTGTCACT
CCCACATGATTTCATTTCGCAATGCAAACCATTGGTATATCCAAGTAAGTTTAAAAAAAATCAAACCCCAGTGAGCATTCGGGGACTCATTCCCTTCTTG
TGCACTAGAACCAGCCTCACCACCATCTGCAATCGATTCCGGCTTTCTTCCGCTGCAGAAGTTCTCGTCAGTGGGTTCCTACACGGTGATGTTTTCGTCG
GGGGGATTGATGAGCTCATCGGATCCCTTTGCTTGAATGAAAGCGCGACAGTGTTGTCGTAAGTACCACATACAGTCCTATCCCAAGATACGTGCAGTCT
TTCTTGTGTAGATTAGTCACTCTCAGAGTGACTAATCCGGGGTTCATAAATCTTGCGCAAAGCGAGCAGATCTCCACGGAAATGCTAACCGTCGTCTGCT
CAATAAAACCCCCGTAAAAGCCTCAAATGACTTGAGATCCGTGTTGATGAATGGAAGAGTTTGCCGTCTTCCTGTAGACAGTCCAACAGACTGACAATGC
CGATATGTTTTAGCTCATTTTTCCTCTTGACAATGTTGACCAGTAGTTGATCACTGAAACAGTAAAAGCTATGATATTCGCCGGGCATTTTCATCAGTGA
TAGATTCAATTTTATGTTGGTATCCTCTTCAACAGCATCGCATCCTGACGTACGTAACCATTGTTTTTTGCAAAATACAGAAGCCGCCCCTACTTTTCAA
ATTGCTTTCTCAACTTCTTATTCAGGATACCATAATATACCATATTATGGTACACAACCTATCAAATCATCACTGTGAACTCGGCATCATCACTGTGAAC
TCGGCACCTTGATGTATCTCAACGCTGAGTTTAGAATTTTGTCGTGTACTCAACAAGCGTTTGCTGCTGCCTCGCCTCAGCATAGCAAATATTTTCCATT
GAAAGTCGTTGAAAGGTAACAGAAGTGGGAGCGGTTTCTGAGCTTTCCCGAACGACGTGACTCCAGAAGTTCAAATTCCGCACCCAAACTCAAACAGATC
GGCTCCCTCCCTCCACAACAAAAAAACTCAGCCTACTTCTTCACCATGCACTACGTGTGCCCTACTAAGGACCCGACCTCCATTTCAGTGAACACGATGC
GTTGTGTCTCGTTGTCCAGACGCATCCGCCAGACAAAGCCTAGATTTCCTGAAGAACAAGAAAGCCCTATCGCGTGACAGGGTGTTGCTGGAGACGTACC
TGGTGGAGCCGGTGCTGGAGTTTGAGTCGCGAAGAACTGTATTGTTGGGAAACTAACTGCAGCCGTCTATGCTGGCACTGCAAAAGGTTCGATTTTACAG
TGGCTCGAGACTTTGGACAAGGCGATGGGGGAGAGCGACAGATGCATCCTGCTGCTGCTAGACAATGCCTCTGATCACAAGATAGTAGAAGTTCCGCCAG
CAAACGTTACAGTCAAGATGGAATCTTCAAAAACTACGGCACTGCTGCAGCCTATGAGCCAAGGGGACATCGATTGGGGTTTCTACACGAGGTTCCACTC
CGCCTTCTCGATGGAGACCCAGACCGGTATGGTATTGCGCCATTAGAGGCATTGAGTATATTTGTGACGCGTAGGGGAAGATGCCTGCAGACCGTATCAA
CCAGTATCCCCCTCATGTTTTCTTTGTTTCTCGAGCGACAAATTAAATCCTAATGAGATATGTTCTTGGAAAAATATTGAAATGGGACCATGCTATGCCA
TCAAACTCCCCAGCAATCTAGCTGGCAGCTGCATAAACTACGCCGTTTGTAAAACTGCACTCCTGTATAGCTGCGCTGTGGTTTCTCTGATTTTCTTTGA
CGGCATGCGCATGCATTTTGAAGTCAACAGCATCAAGAAAGCTGCAGCTCATTAAAAGGATTTCGTTACCTCCGCCTGGCTCAAGTCAGCGCTGCAGTCG
AAATTGACAATCGAGCACCGTTCAACTGTGTCAACCCGGAAACCCCCAGAGGCGCTGTTGGTAGCAGTCGGGCTGGCAAGAGGCAAGGACCACACACTCT
AATCTAGAATTTCAATGATGACCAATTCCCTCACACAATTTTTGTCAAAACTCGGTTTACTATTTATTCAGCTTCTATCGCAATATTCAATCGCGATAAT
CTCAAAATTAGACTTTAACCCAATAATCGCTCAAACTTTGGCCGCATAATGGCGACGACGCTCAAGAAGTGTCTGAAGCTGCACAAGCTCTTCATGGCCG
AGGTTCGACACCGACCCTAGCTGCTCTTCGACTCGGTAACTCATCGCACCTCATGCCGCTAACTTTTACGATTGTCTATTGCGTCTTGTTTGCTGTCGTA
ACGACTGGCGCAGGTGGCTCGCAGCTCTCGCCTCGAGTCGGAAGGTTCGCAGGTGTTGGCGTCGCTTGCAAATGTGAGTCAGCGCGTACCGACGCTCCTG
CAGACTGGCGGTGCAAGCCTGAACGACAATGATGATGCAGACGGCAGCGTGCAGGTAATGGGCGTGTTGAGCTACTCAAGTAACAGCCAAAATCTGCTGC
TGCAAAAGCACTTTTTGGCGCTGGAAAAGAGCCGCGGATTCCTGGCAGACATTTTGCGCGACTTCCAAGAGTTTCTTAAAGGATTGCGGTCGCTCACGAG
CGACTGCGTGACGCTCGTGGATGACGCACTTGCTGAAGGAGAAAATGCTGCAACTGCGGAGGACGAAATGGCAGCCGTGATTTTCCCGTTGCAGTTGCAA
GAATGGATGGAGACGGTGTTGGCCATGTTCGAGCATGAGGTTTTGCGCAAAACGAGGCTGGTTGCAGACTTGGAGTA