Description :
From Genome Similarity Track
Location :
Scaffold_89:226429- 230820
Sequence
4391 bases(100 bases per row)
TTCACCTTCCTATAATCAATGCATAGTCGAATATCTTCCCCATTTTTCTTAATGATCACCACGATAGGGGAAGCCCAAGGTGAGGTGGATGGTTGGATGA
TCTTGGCCAATAGTAGTTCCCTGATCGGATCTGCCAGTTTCTCTCGATATTTGAGTGCCACTGGCCGTACTCTCTGCTCGATCGATTTAGCACTTCCGAC
AACAATATCTCATACCGCTCCACGCGCAGCTGGAGGCAGAGCATCCCCCTTGCCGATGAGGAAATGGAGATTCATTTAGATCAGTTGCCTCAACTTCTCT
TGATCATCTGTCAGTGGTATACCTGGATCGCCAACCTGGATGTCTTCGATAGCCACCTCTACCGTGGGAGCGACTATTACTGACAAGATCGCCATATGTT
GGTCCACGTCTTCGTCGAATAGGTCACCGGCTTCATGGCGATATACCGCCTTTTTTGTCGGAGTATTATCTGCTGAGTCTTCTTTGATCGTGGGCGTTGT
AGCGCTTTTACTCCCTTAATCTGACAGTCTTAGCTCCCAATCGTTCTCATCCCGGGAATCATCTTCGGTCGCGACCGCCTTTGCTTGCTACATTGCCTCA
TCTAACCGGTTCTGTGTCGGATCGCCATCCCCTGCTTTTGCAATCATACTGACCACAGCAGGCATTTCTAACGATTACTGCTCTTCATTGCAAGGGCGGT
ATTGATTCTAGATATTGACTCGTTTTTCGCGTTTCGTTCCACCGCTGGTTGTGACACGACCTTCCCCGATCGGCTTACCTCCGTTTCCTTTTCTTGTTTC
TCTCTGTTCGTCAGAATCTTCTTTGGGATGGGGTACGACGGGCGGTCCACTAGAGGCCCCGAATACTCGATCAGACGTTCTTTAGTTAACTCCTTTGTAG
CTTCGAATGTCAAAGTCTATCATTCATTATACCGGCGTGATCCGACCGACATATAGCCCGGTGATCGAGGTATCATATCCGTCATCATCCACCACCCTAG
AGGTGTATCGTGATCGAGAATCACCTGCTGATCGACATTATTGGTCAGTATCAAAAATCTGATCTGGCCGAGGCTAGTAGTTACCGTCGGTACCCACTTC
TTGTCCCGCCTAACCCATATTTTGATTTAGAGGAACCTGCTCCAATCTTCATTTACGTGTATACTCCGACTGGAATTACCACATGTTGATCTGGGGCAGT
GATCGGTTGTATATTTACTCCATATGGAGATCTTCGCCCTGTCAGATGACTTTATACTTCGTCTGGCAACAAAGCGTACCGTCCGCTAGATCCAACTGTA
TCCCTGCTGGCACTATAAATTCCATACCTAAGATTACTTCTTGGCCAACTTGATCGCCTACCCAAACATCAAAATAATAAACAATCGATCCGTTTAGTGT
GATCTTGATCTTGGTGCGCTCTTCAGTCATGTAGGACGTCCTTCCCGATTCCCACACATTCTTGCTTCTGGCTGTCATCGATCATACATCCCACCTTACG
AGCAAAAGTAGCGTCAATGATTAAGACTTCGGCTCTAGAATCGAATAGCATAGTGGCCCTTTCGTTGTTGATTTGCCCACCGCTTTAGCTTGTTCAAACC
ATTTTCCTGGTGTGTGATATTTCCAATATCCTCGCGACTCTCCCGGCGCTAGATCAAGCTTCATCTTAACGGAAGATCGCGAATGTTCATCCACCCTTTT
CACACTTGAAATATTAAACAAACGATGATGTTCCAAACCACATGTATTAGCTATCGGGTAGATCCGATTGTTACTCCCTTTATCGATCCTTTCCGTCTCC
ACAAATGCATATATGCAAAGCCTAGAACGCTCGGCTCGTGCCAGATTCTAACCTGGCGAATTTCCTAGTTTAACATCTCCTCCGCCTTGGTCGGTAGTAG
CCCCGCTTTCTTGGTTGGTACGTACCACTTGCGGATCAGGTTGTAAAACTCCTCCATGGGACATTGGTCGCTCTCATGAACTTCCCCACAGGCGAAACAC
ACACGTAGGCATTTGTCCGAGGGATATACTTTGCGGCCACACTTTTGACAGGTCAATCTTTTTCAACATCCGCGATCTTCATGTCTTTTCGAGCCGCAGT
GTGTGCAGGTTTTCGAAAGTCCGACGCGATTGCGATCGTCGTCCCGATCTGTCTTCCGCGATCTGTCTCGTTGCTCTCCCGGATCTGCGACCTGATCAGA
GGCGGTAGTCACACGGACTTTGCGGCGAAACTCTTCTTCATCCGATCCGTCCGGTCTTGAGTCCAAGTCACTTTCTTCACTTTCCATGCGAATGGCTTTC
ACTACCCGTGGCTTTTTTTAATATACCGGAGCCGACGCTGTAGCCGATCGCGATCGGAAATTATTCGATTCGGCCGGATCTTTATTCTGTCGAAAGCTCA
CACGATGATACGCGTGTAGAGTTTCTTCAATCGTGTTAGCGTCATGTACTCGCAATAGAGACAGTTGCTTCGCCAGATCTCGATAGTCCAAAGTATCAAT
GAAATGCTCCACATGCTCACGTCGGCACGCCGGCGATCCATCACTGAAACTCCACATTACCTCGCATTCCTGCCACATTCAGCCGGTGGAGATATTCCAA
CGGGGTCTCATTCGGTCGCTTCCGCGCATGGTAATATTTCCTCCCTGCTGACATTCCGTATCCTCCGTATTGGACCATGAAGCTTTCTGACAATGGTTTC
CACTCATTACGGGTCGATCGGCTCAAGTGGTTGTACCAATTTTGCGCAGGTCCTGTCAGCAGGTCTCCGAATACCAAACATGTTTCATCATCGGGAGCTT
GATCAAGTAAGAAGGTAGTCTTCATCTTATTAAACCAACTTCTGGCACGTTCTTCGTCTTGGTCCCGCCCTGAAAATTCTTTCAGGTCAGTCATCGCCGA
CAATCTTATCCTCTGCGAGCTGAAACCTCCCGTAGGTGCGGTTTCTGTGGTTTCCAGCTGCGGTCGCCTTAGGTCGCCGAATCCCTTATGGTCTTGCTCG
AGTTCGCCCGATCGATCGCGGTACGATTCAACGGATTCCATTTCGACATCTTGGATGTATCGCTCTTGATAATTTGATGTCCTTTCTTGGACGACCGGGT
GACTTCCTCCTTGTTCTTCGCGATCGCGAACTTGTCCATAGCGGCCTTGAAATACGTTTGTAGTTGACTTGGTTCAACCGTGGTTGCATTCATTGAGGCC
GTGCTTGAGTCGATCGCAACCCGCTATTAGCCGAGTCGAGCTTGTCTCTCAGCAGCGCTGCCCCGTCAGCCCCAGCGACATCCGCTGCATTCCAAAAGAT
TTGGATGAGTCCAGATATAATTCTACCGAGGCATAGCGCGATGACCCTGTATATTATTCTTTCACGATGCGGTCGACCGGCTCGATCACTTGGCCCAGGT
GTTCTTCTTTCGTGATAAGGTAGATCTGCTTAATCCCTCTGTCCGTATTCTCCACTTTCTTGATCTGTTGATCCACACGATCGTGAGATCCCGTTAGTGG
AATTATCTTCTCGAATAGTAGCCACCCTGCCTTGATCACACGATCGTGATTGCACTCTAAGAGTGTTTGGGCGTCGAACTCTCCGGTCGTAAATTCGGCG
TCTCGTATCAACTAGATAAGACGACGTAGTGCCTCCAGCTAATTCGAGGTCACTTTTGGTGGTGATACCGGGACATGGATCGACCAGATCAGTTTAGGCT
TCAACAACTTTAGAACTGGGTCTTCTGCGAGAAGTTTCTTCAGTTGTTGCCAATGAAATTCCCAGGTGATCCGTTCAAGCTGCCAGGCTTCTGATTTCGT
GTCTTGACCTTCCGTCTTGATCGATTGCTTCTTTCGATATGGCTCTGCCGTCTTCGTCTTTGTTCGGGACATCTTAGGAGTGTGTTTTCGCCTTTGATTG
AGCGGTAGTTTTGGATGAAAAAATTTCAGTTTTGACTGAAGGATTTTTACCCGGCAGACCATGTGTTGTAGCATGATCTGCGGGGGTCCCCGAAGGGACC
TCAGGAGGGGTTGGAGGGTTTTCTTCCAGATCATCTTGATCTTCCTCTTTAACTCTCTTGTCATCATAGCTCCTCCCAGAACTTTGATGATCTTGGAATC
TTTTCTCTTCACGCGTCTGCGGCGATCCATCTTCCGCTGGCGCTTCAATCCCGGGTTCAGTCTTGACTTTAACATCTTCATCACGGGACTCACGGTGAAA
TCCCTAGTCACCAGAAGATCCGGGCACGCGCAGCATTGTGGTTGAGTGGGGTTCGCTCATTTTATGAGGCGATCCCAACTCTCCACTGGCGCCTAGACGA
CCGAATAACCGAGGGGGTACTCCGAATTGGCTTGCACTTGTTCCTTCCTCACTTGTGTACCTGTCGGTAGGGAGGGCTGCACTCTTCTGGT