Description :
From Genome Similarity Track
Location :
Scaffold_281:22640- 24753
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_281-snap-gene-0.25B-box zinc finger family protein

Sequence
2113 bases(100 bases per row)
GTCAGCAGCTCATTCCGGATTTGCTCGATTATCTGAATGCCATTTGGCGACAGAAACGTCGCGGACGAGTACTTGGGATGCGCTGTTGACGATGTAGTGC
CGTTGGAAAATTCGCTTGGAAACGACATCTTCATGCTCAGCAGCTTCTTTCGAATGTCGTTATCGGAAAAGGAGTTCCCACGCTGTGTGGAGCTGCTCAG
TGCTTCGTGACCAAACCTGTTTGCTCGAGTGGAGCTAATGCGATTGTTGCCTTCGCTACTACCGTCACCATTGACAGCATTAACAGTAGCAATGCACATT
TGCTCACCACTGACCACCTGAAGTCGCCCAGCCAACTCGAGATCGCCCTTGACCTGCTCTGCGCCGTTTCCATGTGCGAACGCTGGAAAGTCGCGCTGCT
CGGTTCGCACTGCCTTATGCCGGTTCCACGTGCTCAGGAACTCGACTGCGGGACAACTCGAGCGCAAATCGTCGAGCGTGTCTTCCGCCCACTCGATTTG
CTGCAGCTGTCGCTGGTATTCGAGCACTTCGCCGTCCAGTACGCTCATTTTCGCATGCGCTTCTTCCTCGAGACGCGCAAGCGCTTGCTGGCACTGGAGG
CGAATCGCGGCTTCCACTTGCTCACGATTGCGCAGTACGTCCTCTTTCGACTTCGCGAGCGCGTACAACTTGTTCTCGATCACAGACTTTCGTGATTCGA
CCAGCGGATCACTCTTTAAGGACTCACGCAGGCTCAACTCGTATGCATCCGCGATTGTGAGTAAACGATGCGAGCCTTTCTCGCCCACTGAGTGGTCGCC
GACCATCTTGCAGTGCACGCACACGGGCACTTCGCACACGGAGCAGTAGAACTCAACGTGCTTGCCCTCGTGGAAGCGACAGGTCGTCTGGATACCCATG
AGCCCTTCTTCCAGTTGCTTTGCGATAATCGTTACTGTCTCGTTTTCATCCTGTACTTCAGGAGAATTCGCAGTAGACACTGTTGAGCTAGACGGTGACG
ACCCTGCAATACCACCATCGTCTTCATTGACTACAGCAACTGGCGGGGTGGAACTGCGACGACGCGTAGCTCGGCTTGAAGAAAGCGCTCTGCTGCTTTT
CACTTTCTGGCGTAGCGGCACGCGCTTATGGCGACTCACGAGCTTGTTCGCAGAGTGCACCTCTTGATCGCACATCGAGCAGATTTCAGCTTCACACACA
CGACAGAGCACTGCGGCCGAATGCTTTTCGCAGAGTGCACACGGTCCTGCAGTCTTGGAGTCCATCGCACTGAAGTGGAACCGAACCAGGTACTGCGGCA
AAATTTGGTGCGTGTTGTTGAGGATGTATTCATGGTAATACCCTCGCTCGCTGGTGTCCACGACTTGCTCTTGTTCTCCTTTCTGACCACTCTCGTGCTG
CTGTTTGAGATAGAAACTGTTGTACCCCGCTGGCAGTTGCTTCTTGGCTTCTTCCTCGTTCTGGATCACCAGCGATCGTCCGACTGAGACCTTGCAGAGC
ACCAGCTGCCGTGTGCCTTTCTTCTTTGCAGGGAGGTCGAGCTGCAGGTTTCCCGTCGTGAACTTCATGCCGGTCTGGTTCGCATTGAGCGACGTGAAGC
CGTAGCCGTGCACATCACCCATCGCAGCACCGAGATCATTCACTGCGACCCACGAGTCCAGTTCCAGAAGCCCTTGGGCATGCTGCTCGTACTGCACGAC
GAGCGACGGGTTAGTCATATCCCACATCATCACGTCGTCGTGTACTTTGTACCCAGGAAGGCAGCACTGCAGCAAGTATTTGACCCTCGAGAACTCTCGC
GTCATTTGACTCAGCGGACTCACGCTCGCGACAGCCCCAGGAGCGGGGATCGTCACCTGGCCGGGTTGGAGATTGTCTTCATCATCGTCAATTGCCGCCT
CCTCAGGTGCAAAGCTCTCCTTTGTGTCGCTTGATGGATTGGGTTCGCTAGCTGAATGTGACTGATAATGGTCTTGATCGACAGTGTCTTGGTCCTGGGA
TTCTGCCGTGCTGTTGCTGCCTGACGAAGCTTGATACTGGAGATGATTCGAGGAATTGGCTTTCGCGGACGAATGCGGCGCCAGGAACAGACGAAGGCGA
GCCAGCGACGCAC