Description :
From Genome Similarity Track
Location :
Scaffold_1623:2264- 3936
Sequence
1672 bases(100 bases per row)
CCTACGCGGACTGACATGAAGCAAGTAcagtatacatgtatacatgcGCATGTAGATGCAACATCTGGCTAGGCACAAGTGAATATGGTGCGATTGGAAT
CCCTAGCGAAGACAAAACTGCCTTGCCCTGAAAATGAAGTCGGAGGGCACGCACCGCATGAGAGAATTGCACACCTGTAGATGTTTCACGAAATTAAAAG
CTGTTCCTCGCATTGCATTGCAACCTCAATCCACGACAAGACAGTCAAGGTTTCAGAGGTGGGATTTCGGAAGGATACGTGCTGTGCTTCAGGAACGACG
AACATTCAAATACCCCTTCCCGATGTACATGCAGAAGTTTGAAGCAATGAGGAATCGACAAGAGAATTATCCGACGACGCCTCCATCCATTGCACGTCAC
CAATGCAGTGCAAGGAAGATAAATGGCTAAGCAGACAAGCAAGAGATCTATCCGATTCGGAAAATCTTTGCTTGTCGGATTCCGACGGCGCATGGGCGAC
AATGACAACGCGGGCAGACTACACTACCGGTATCGAACCCTGCCGTCGGAAAGATCACCCTTCTATTAGGATTTGAACGGTTCTCCTTTTGACTAGCGAT
TTGTAAGACAGGTCTTCTATTCAGATGACAAAAGACGCCGTCGGACAAAATGCTACGTCGGTCGCGTCTCCTTGCGCGCACAACTCAGCGGCGGGCAGCG
ATGAGTTTGTTAAACAAGGTCATCAACTGCAATCGAATGGCTGAGAAGCGACTTCGATGGCCAAGCACTTAACGAAAAGACCTCGTTTAACTCAAGTGAA
GGCAACAAAAAGCCCGGTCCTATCTATTGGCCGCGTGCATATGAGAGATCATACGACGTTATCGCTTCCCTTCCAAGGTCTCGTTTCCTTCCCGAAGAGC
GGATTGTGAGTCAACCATGAAGGCAACGGCGGTAGACTCTACCGCCGCTCGCTCTACCCGGTAGAGCGAGCCCCAGCCATTGATCCGTGTCGCAGGTGCC
ATTTCAACCACGCTATCCGACGGCGACACCCTCATCGACAACAGCTCGTCCAAATTGACGATGCGAACATCGTTGATCTGCAAATATTGCTGGCTGTGCA
GTGTGCTGGATCTGAATCTGGCCGTGCATAAGGAGGCCAAACCATGATGTCGCCACGCAGACACATTGCAGTCGTCAGCAAGCTCAACGAGCGTGCGCGG
CCACAGACCGAGAGGAAGCCTGCGACAGCGCTGGCTAAGGTGTCCGTCGTCCGTGCTGCATGTACAATGCACAGCTAGCGGTTTTCGCTAGCCTGCTCCC
CCCTGTCCGTGACATTCGTCGACAGTTCGTGTTAGCGCCAGCTGGGGCGACACCACGTGCCATTGGCCCGAGGCACGAACTCGCGCGTAGGCTCCTGAGA
AGCAGGTCTGCATCTTATGGTTGTCATTCTGTTCGAACTGCTGTTGCGGCCCAAAGACTGGGCGAGATTAATTTGCCGCTCGAGGCTTGCAATTGTACGC
TTACCACAGCGCCTCCATAGCCAATAATCGCTGCAAGAGGGAAAGCAGTTTGAACATGCAAACAAAGATGTGCCCTAgtggagctcaagcacaTCGCGAA
GATTGCTGTGCTACTTTCGTCCGGATCAAGTCCCCCGTACACAACACAAGTCGATCAACACAGAGGCCGAGG