Description :
From Genome Similarity Track
Location :
Scaffold_1474:2264- 3386
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1474-snap-gene-0.1Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_1474-snap-gene-0.2Serine/threonine-protein kinase rio2

Sequence
1122 bases(100 bases per row)
AcTtGCTCTCGATTGTGTTCAaGCAtcGATCGCcGATgcTGCACGCTTTCaCaCCcAGaTAAATGcGTTGGCcGAGTGCCTCAAAGCCCACGAGGAGAAT
CTCcAGGgCCGCcTAGCTGTCATCGAAGGCTTCCTtCGTAACATGCcACCGctGgcACGTGAGGATGTCATCGATCCTTtGCTGGCGaTGAAAaaCGTCG
AAGACACAGAGCACGAGGAGTAGTGTCAAACATGATCAAGAGAaTCAGGAACCAGTTCATGAGATTTGATATTAATCTAACGTAGTAAAGCCAAGCAGCT
CGCCTACAACTCCGTTCATCccATGAGCTGtAGTTTCTGTTGCCAgCGGGCCAACtGGATCGAAATAACCTGGTTGTTTCCATCCGCAGTGTTCggaTAC
CTTCGCCATAGTGAAGCCTTCAAAACGCCGAAACGtctCTACGATGAATGGCCGtAGATCTCTCCCGCTTCTCTCGTTgTAGTGCCTCTGAAAGGCACGC
TTGACGTACCCAAACATGAACTCGATGGGGTTAAAAAATGGGCAGTAGGCTgaCAGGAAGATTGGCACGACTCCAACACTCCGCAGGTAGTGAACAATCT
CTGGGTCACGATGGATGGTGGCTCCGTCCAGGATtcAAACTGAGTTACGGCCTGGGTACTGCTGCACTTGGGCCCGAGACGAGTGAACGAAGTCCTGGCA
ATTCTTCGTGAACTCCACCACGAATAGCGTAACCACGCTTTCGAATCATTCCGCGGTTGTCGAAGGAAACCTCGTCCAAAACGACGAGGTTGAGGTGGCT
CCAGTTGATGCTGCTGAGCTCTTGTACAAACCGGAACACGTaGTGCTCTTTTACGTGCATGGCACGGCGCTCTAAGACTTCCACGTGAAGCCGAGATCGC
GAGCGATGCGCCAAACGGAGCTTTTGGAGATGCTGGTGCCGAaTGCACGCTAGAACGCTGCTTGAGCCTCGTCCAaGTACGCCAGTGGGTGTTCtGTGTA
GAACGCAAGTAGCCATACGCGCTGCTCGTCAGTGAAGTGTCGCGTCGGAGTCGATCGCTTTCGTTtGAaCTCGCCAAaCTCCTCATACGTCTTGATCCAA
TTGTtGAtGGTGCGCACAGTCT