Description :
From Genome Similarity Track
Location :
contig_137:22639- 25158
Transcript NameFunction/comments
g11622.t1reverse transcriptase

Sequence
2519 bases(100 bases per row)
GAGCGCTTCGCTGCGCAGTCGTGGGAATCGCTGAAGGCGTCCGGCAATCCGGTCTACGAGACAGCTCGCGAGTTCGCCGACGTCTTCCCAGACAAGATCC
CTGCGGAGCTGCCAGCGGATCGCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGCCACTGCCGCGCGATCA
AGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACCTTCTGTGTGAAGAAG
GCTACTGGCGGGTGGCGCATCGTACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGGACATGGTACTGGACT
CCATGTCGGGCAGCGTCATTTACAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCTCACGGCAGTCAGTAC
GCCCAGCGGTATGCTCTGGGAGTGGCTCGTGATGCCCCAAGGTCTGAAGAACGCACCAGCCACATTTAATCGCATGGTGTCCCATGTGCTACGCCCGCTT
CGTGACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGATCGACGTGCATCTGCGGCACTTGAGGCAGG
TCTTTCAAGTGATGAGAGAGAACAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTGCTACGTAAGCAAAAA
CGGAGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTGGGCCTCGCTAACTAC
TTGCACAAGTATACGAAGGGATATGCCGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCCCCGAGCATCAAGTAG
CCTTCGACTCGGTGAAGAAGAGCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTTCACGTCGTCTGCGACGCTAGCGACTTTGC
TATCGGGTGCGCGCTCATGCAGTTTGACAACGAAGGCCGCGAACGAGTCGTGAGCTATCAATCACGACAGATGAAGCCGGCCGAACGCAACTATCCCGTC
CACGACAAGGAACTTCTTGCGATGCGATACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGAGAACAGACGTTCGCGGTGTACACGGATCACGCATCGC
TGCGCACAGCGATGAAGTCTCCACATCTGTCTCAACGCATGGCACGATGGCTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCACTACAAGCCCGGCAA
GAACAATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGATCCACGAGCGACGCGGGGTCGTCAAGTGATTGACGAAGACGAGGATGACGAAGAT
CACTGCGCGATGTGCTTGACATCAGGTGTCAACCTGATGAACGTGACCCAGAAATGTCGCTACGCGAAGAAATCGCCGTTGCGTACAACGACGACGCGGT
ATATGCCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAATAACACGCGCAATCAGATTAACCGATATCAACTCGAC
GGCGATCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCGGATCATCCACGAGTTCCACG
ACAGCCCTGTCGGTGGTCACTTGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTACAAATGGGTGCGCAAGTGGGT
CCGTACTTGTGAGATTTGCCAGCGCGTGAAGCCGTCAAAGTCGTCGCAGGCTCCCCTGCGACCCCTGCCGATTGCAACTGAGGCGTGGCGCTCAGTGTCG
ATGGACTTCATCTTCGGGCTTCCACCCGATGCCGACGGTCGGACTGGCGTCTTGGTGTTTGTGGATAGGTTCAGCAAGATGGTGCATCTCATTCCGGTGT
CCGACACGATCACCGCGGCTGAGTCCGCGGTGCATTTCGTTGACGCGGTCTTTCGACACCACGGCTTACCTGAATCGATCGTCTCTGACCGCGATCCGCG
GTTCACGTCGGCATTCTGGTCGAGTCTCTTCCAACTTCTGGGAACGAAGCTGCTCATGTCAACGGCGGCGCATCCGGAGACGGATGGTCAAACGGAGCGG
GTCAACCGAGTCCTCGAAGATGTCCTTCGAAGTTACGCGACTTCGTTCACTAGTTGGAGCTCCTTTTTGCCGCTTGCCGAGTTTGCGCTAAACAACGCGG
AACACGCATCGACGGGTCTGACCCCTTTTTTGTAAATAACGCGCGGCACCCGCGCGTTCCCGCTCTGCTCGCCGTGGGCCCCCACGATGCCTCGTGGCTC
CACTCTGGGTGGGGAAGGA