Description :
From Genome Similarity Track
Location :
Scaffold_37:226383- 253344
Sequence
26961 bases(100 bases per row)
ACACTCATGGAATCGTTCCAGTTATACCGGGAGCAAGTGGAACAGTACTTTTTAGCAAAGGGAATTGATTGGAAAGATAGTAAATTGAGAGGACGCATAT
TGGTAGTGTTGGGAGGGTCGTTGAAGGATGGAGCCGCGCAGTGGTACATCGTCAAGAAGGACGAGGTGCAGAGTGTTAAAGACTTCTTTGGCAAGTTAGA
GGGGAAGTTTGTCCCTTCAGATTTGCAAGAACGTCTAAGAGACCGGATGAACGACTTGAAGGAGCGTCATTGCAAGGATTTGCCTGATTATATCAGCAAG
TTCAGGCATTTGATTACTCAAGTCAAGGAAATGAGTGAGCTGGACAAGATCATGTATTTCTTGCAAAAATTATCGTCAAGTATCCGCGAAGAAGCCCAGT
ACCGTACGGGTGCAACTTTGACCGACGCTATTACAGTAGCACTCGACTATGATCGGTCTCACGCGCATCGTGGACGTTCAGATAACGCTCGCGATAAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCGTTAAGGTTCAATTTGTAGCAGACGTCGAAGAAATCCCTGAACCTATTCGTAAGGTAGTTGCTGAGGAGTTCAAGG
ATGTATTCCCTGAACAGTTGCCTGACGGTTTGCCACCGTTGCACTCAGTCAACGTTAAGATTACGCTGAAAAAATGAGCTCAGCCGAGTAATCGAGCACA
GTTCCGTATGTCAAAAATGGAACAAGATGCGTTCGAAGAGTTTGTCAAGGACAAATTGAAGAAAGTATGGATCCAAGTGTCGAATTCCCCGTGGGTTTCG
AACATCTTCGCAATTTTGAAGAATTATCCAGTAACAGGGATGATGCAAAAGAGAGCAGACTGGCTACGTAGTGGGAATACGAAGATTCCGCTACGATGGT
TTTTTGATTACCGACACCTTAACCAGGTGACAGTTATTGAAAAGATTCCGCTGCCTTTGATCGAAGAGCGATTCGATCAAATGGTTGGATGTGTCGTGTA
CAGTTTAATCAATCTTGCGCAAGGGTATCATCAAATAGTTGTGGTAAAGTCAAGCCGACCGTACACAGCGTTCCGCACACACAAGGAGACATATCAATGG
TGTGTACCACCTATGAAAGTGGCAGGAATGCCAGGAACATGGTCACGTCTGATGCGTACACTGTTCGACAGGTTTGATTTTATCGTCGTGTACTTGGATG
AGCATCTTTTCCAAGACTATGGAAGAACATGTAGAGCATCTGTGTGCCGTCTGTGAAGTGTTGCGCCGAAAATAACTGTACGCTCGGTTGTCTAAGTGTT
CGTTTGGACAATCAGAAGTGACATTCTTAGGACACGTGGTGTCTGAAGCAGCGGAAGACTGATGCAATTGAGAAATACCCAACCCGACGAACAGAAAGGA
GCTATTGAACTTTCTGGGGTTAGCAGGGTATTACCGGCGGTTCATCTGTGATTTCGCAAAGATTGCTCGCCCGTTGAGGGAATTAACGAAGAAAGACACG
CCGTGGTTGTGGTCTAAGAATATGGAAGAAGCTTATATGCATCTCAAAATTCCGCTCCAACAGGGGCCTACGCTAAAGTTACCAGATTTTGAGCGACTAT
TCATTGTAACAATGAATGCTCCTGGAGAGTGCATTGGAGGGGTTTTATCGCAGAAGTATGGCGATGAAGATCATCCAGTTGCGTTCTACTCCAAGAAGTT
GGATCGACATGAAAGAGGCTGGCCGACGCATGAGAAAGAGCTCCTAGCTATTAAAGTGGCTACGGAGAAGTGGTGCCACTACCTACATGGCCGTCCGTTT
GACGTATATACGGACAATTCGACATGCTCCTGGATGTTGTATCATCCACGAGTGTCTTCAAAGATGGCTAGGTTCCTCACGGATTTCTCGCAGTTACATT
TACATTGCACCATGTTAGGGGCAAAGCGAATGTAGTTGCAGATGCACTATCACGTCCTCCACCGGATGGACAGGATACGGAAGAGGATATAGAACCATCG
TTACCAGATGTGACCTATGAAGTCCATGACTGTGATGAAGAATGTGCCAAGATGGCATCACAGACTCATGATCAAATGGTTCANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTATATGCATCTCA
AAATTCCGCTCCAACAGGGGCCTACGCTAAAGTTACCAGATTTCGAGTGACTATTCATTGTAACAATGAATGCTCCTGGAGAGTGCATTGGAGGGGTTTT
ATCGCAGAAGTATGGCGATGAAGATCATCCAGTTGCGTTCTACTCCAAGAAGTTGGATCGACATGAAAGAGGCTGGCCGACGCATGAGAAAGAGCTCCTA
GCTATTAAAGTGGCTACGGAGAAGTGGTGCCACTACCTACATGGCCGTCCGTTTGACGTATATACGGACAATTCGACATGCTCCTGGATGTTGTATCATC
CACGAGTGTCTTCAAAGATGGCTAGGTTCCTCACGGATTTCTCGCAGTTACATTTACATTGCACCATGTTAGGGGCAAAGCGAATGTAGTTGCAGATGCA
CTATCACGTCCTCCACCGGATGGACAGGATACGGAAGAGGATATAGAACCATCGTTACCAGATGTGACCTATGAAGTCCATGACTGTGATGAAGAATGTG
CCAAGATGGCATCACAGACTCATGATCAAATGGTTTAAGCATCAATGATCCGTCATCTACCAGCAGATGATTTACACCTGTTACTCGACGATGTCGATTT
GCAGGGGGAGAGTCGTCCTATTGGTGTACCGCAGCAGCAAATCAACACCGTCGATTACCATTTCGTCTAATCGCACTTGGGACCGGAGACGAAGAAAGCG
TTTCAACAAGGCTACGGGTCCGACCCTGTATTCAAGCAACAGTGGTCGAAGGGGACAGACAAGGAAAGTTCGTAAAGCATAATGATCTTCTGTTGTTCAA
ACAGAAGGAAGGAGAGTCTGTCTTCAGATTGTGTGTGCCCAAGTCCAAGAAGCTTCACACGGATGTCATCACAGAGTTCCACGATGGCAATACATCCGCG
CATCCGGGAAGTAGACGGACGTATCTGAAAGCAGCACAATGGTACAATTGGCCAACGATGGATCAAGATATCATAGAGTATGTGCGTACTTGTGAAACGT
GCGCAAGATGGAAGTCCAGCAGTCAGAAAAAAGGGTCTGCTGATACCAATTCCAGCTTCATTGGAATGTTGGGAAGTGGTGTCTATGGACTTCATCACCG
GTTTACCAGTGCCAGAGCGGTACGATGCGATTTTCATTGCCGTAGACAAGTTGTCTGAGCGTCCGAAGTATGCACCGACCTATACGACTGCTGATGCGAA
AGACACAGCTGAAGTATTCTTTAATGCTGTTGTCAGGCACCATGGCTTACGGCAAGTGATTATTAGTGATCGAGATCCAAAGTTTATATCAGACTTCTGG
AAGTCACTGATGACGCCGATGGATGTCAAACTGAGTATGACTACGGCTCATCGAACTCAAGCTGATGACCAGACAGAGCGTCAAAATCTAGTGCTCGAAG
TTGCACTGAGATGTATGGTGCCATATCATGAAGATGATTGGGTGAAGCATCTCGGAACAATAGAGTATGCGCACTCAACATTGGCAAACGCGTCGACTCA
ATTGGCTCCATTTGAAGTCGACACAGGCCGCAAGGTTCTAACGTTGTGGCAGAAGAGATGAAAGATCTATTGCGTAAAGAAGACGACGTCACCTCGCCGA
GTAAGCAAAGAACTTTGCTAAGGAACGACAGGAGATCGTAGAACGTGCCCAGAAGAATTTGAAAGAAGCGCAAGATANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTTCACCACACGGAGATCCAATTTGTCAACTTTCGTTGCAGTCAACGAGCGACACGCCCGTCATTA
CGTGGCATTGCCATGTATCGTGCAAGTTGGAGGATGTTGCGGAACGAGAGCTGTTCGCGTCGTTGGTGCACTTGCCTGCGAAATTTACGTCCGTTTACCA
ACTCCAAGACGTAGGCGTGATGGGTTCACTCACTGCAAAGCTACCGTCGCACTGGCTACTCAAACATGTCACTGAAAGCCATCTGCCGCAGAGTAGAGAA
CGACGATAATCCAGAGAACAATTGCTGTGTGGGGTGCTATCTCAGGATATGTAGTAGGTTTTCAAAACCACTTCCTATGCAAGTACCTAATAAAAAAATC
TGGTTTCTTTTTTTGAGTTTCCTTTATAGTTTTTGGGAAAAATATTGATCAATGCCCACTTAGATTTCGGCACGAGTGCGTTGCCGCGTTTCCGATTATT
TTTGGCTCATGTTTACTGATTTTCATGTGGGCGGTATTTTCCGTCGATATGTGTACATACGCGCCGAAAACATACTAAAATCATTACGGGAGCACTACAC
AGATCAACTACACTTAGATTCGGATACCTGTGACAAATTACCATGATGCGGTAGCGCGAAAAGTAGAGGTTTGTTACGCAGGTGCGCTATGAGTTGGTAT
GACAGTGTATAGTCACTACCGTGTTTTAGTGCCCTGTTCGGATTGATAAAAAAATGAAGAGAGTGCTTGGGTTAGGATTGCAATACGGGATAACCGCCGC
GCGAGGATAGCAACCAATTGAATGTTGCTGACGCACAAGTTGACAGCACGGCTGCACAATACCGTATTTGTCGGATCGAGTGAGACACAAATAATTGGTC
CTTATCAAGTCAAAAATAAAACCTCGTTTAGGTTTTCTAGAAGCGCGCAAATGACTCCCGCCTCTCAGCTTAAAACGCTCAGTAAGTCACGCAGACCGAA
GAATAAGAATAAGGAGAAGTACAAGGTATACCTCCTCCTCCTCTTCTTAAATATATTATCTAACTCCTTGTTCCAGGGTGCTCTTGCTGCGCAATCAGCG
GTAGAAGCCGCCGCTCTCTTTCGCGTCACGCGCGGCAATATTTAGAGATGGCGCAGAGACACTACAAAGTTAAAGGTGGCTGCTGCAAAAGCGCCTAACA
AGTTCTTTGCACCATCATCTCCAGGCAAAAAGGGCTATATTCGCCATCCTGAGCTCAAACAAAGGTAACATTTCATCAATTTTCAAATTCATATCTGTGG
ATGACACGATAATTGTAATATGTACTTTACTAATCGTTTAGTTTGCTTGACTGGTATCATGCTACTGCAACAAACAAAGGGTTTATGCGTAACGACAAAG
TGCATCATAATGATGATTGGCAAATTCGATGCAGTGTATCAAGGACGCACTGTGCTTTCTTGTCGTGGACAGTTCGCTTTTTAAAGCGGAATAAACTCGT
AGTCCGCCGAATCACACAAGGGAACGAAAAAAAGGGTAAACATGCAGGTATATTGTTATTATTGTTATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAAACGCTCAGTAAGTCACGCAGACCGAAGAATAAGA
ATAAGGAGAAGTACAAGGTATACCTCCTCCTCCTCTTCTTAAATATATTATCTAACTCCTTGTTCCAGGGTGCTCTTGCTGCGCAATCAGCGGTAGAAGC
CGCCGCTCTCTTTCGCGTCACGCGCGGCAATATTTAGAGATGGCGCAGAGACACTACAAAGTTAAAGGTGGCTGCTGCAAAAGCGCCTAACAAGTTCTTT
GCACCATCATCTCCAGGCAAAAAGGGCTATATTCGCCATCCTGAGCTCAAACAAAGGTAACATTTCATCAATTTTCAAATTCATATCTGTGGATGACACG
ATAATTGTAATATGTACTTTACTAATCGTTTAGTTTGCTTGACTGGTATCATGCTACTGCAACAAACAAAGGGTTTATGCGTAACGACAAAGTGCATCAT
AATGATGATTGGCAAATTCGATGCAGTGTATCAAGGACGCACTGTGCTTTCTTGTCGTGGACAGTTCGCTTTTTAAAGCGGAATAAACTCGTAGTCCGCC
GAATCACACAAGGGAACGAAAAAAAGGGTAAACATGCAGGTATATTGTTATTATTGTTATTTTCAAATTTCGATTTGTTTTAAAGGTTATACTCATTTCC
TTGAAAATACTTGTACATTTTAGAAAATTGCTGACGTCTTTTCCCGGACAATAAACTGTGAAGTTGAGGACGGCGGTTTTTTTTCCTACCGCTTACACTC
AGATAGATCGGTATGGAAGCCTCTTCAATATGGACCAAACCGGAGTGTGCATCGACAATCCTGGCCGTTTAACAATACACGTTCGTGGGGCTAAGAACGT
CGATGATGTGTAAGGTACGGGAGAAAACGGGGCGCGCTGCAGTGTGTTTCTCTGCGCATCAGCGCTCGGGAAAAATTACCGGCGTTTGTTGTGTTCTCTG
GTGTCCTGGGGCGGACGTGTACACCGAGGTGTCCAACCCTAATTGGGGATATCCCAGTGTCGTTCATACCACACAGAAAAAGGCATGGTGTGACCATGCA
ACCATGTTGAAGTGGATTGAAGAGGTACATATTGCAATATTTGTCGTGTTTTTTATTTACTAAAGTGTTATATTTTATTTGTTATGTTAGATATGGACTC
CATCTATTGAGGGATGCCGCATCCTAATGCTAGATAGCCTTCGGGTGCATAAGATGGAGAGCGGAAAACAGTATCTTGAGGATACGTGCTGCACAAAAGT
GCATTACATTCCTTCAGGAATTACAGGGCTCAGCCTGCCTATGGACGTGAGGGTGATGCATTCATTCAAGAACAAGATACAGTACGTTTCCTTTATAATT
TTTGCATTTGCTAGCTTTCTAATATTTATGTAGAGATCTATATCTCGAATGGTACAGGGACCACGTTTTTTCTAGAAGCGCAAGTGAACGTCGCTTGCTC
TTGTCTCATATAGTTGGTAAGGCTTGGGATGTGGTGGACAAGGAGACCATTATTTTGTGGTTCGCCACATTGCTAGCACCACAAAAATCAAATGTGTTAT
AAGAGACAAAACTCTAGCGCCCCTCCATTACACACAGTTCTCATGTACCTTCCTATGTCCTACCACCTCTTACTGCGGCTAAGATTAGGACCCTTTAACT
GAATTGGTACGCGTAGAGGACGCTGGCGGACGAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGCCCATGGCTCCCAACACAATCTCTTCAAAGTCGAATCAGACTGACCTTGTCATACTAGATAATCCAAAGACTGAGTCA
GTAGAAAATATTTCGACGGGGTGTCGATATGACTTACCTTACTACGATTATAAAACGGACAAACATACTATGAGAGGTGTCGATGATGTATGGATGCACA
AGGCTGTTTTTTGGATTGTTTCCCGTAACGGTTTGAATATTAAGTACTTTAAAACAGGGGAGCCTATTGAATACTGGAAAGACGGTCGTGTTTTAACCAT
TCTTCGAATGTTCCAAAAACAAACGACAAGCGATGAAAGCTAATGGTGATAATCAAGCATCAAAGCACATTCTGCGATTGGTGTTGACTCAGAAGATGAA
CTCATATTATTCAATGAAGCAGTCCATAAAGTTGAGTGTGATACTCTGATCGATTCAATTTTCTTGACTAAAGACTACGATAAATACTGGTACGACCTGT
GCTGCTTGCTTCCAATGCGATGGCTTGACGACAAGCAGAATCTTTTGAATCTAGCTCGTTTGATTTTCCAGATGCCGGGTAAGGACCCTGCTCTCATGCG
GCGTACATACGCATCCATTCTACGATTTCATCATGGCGAGAGGTTTGTGAAAAGACATCTATGACTTACGACAAGGATGGTCCAAATACTAAGTACGCAA
TTCAAATTGATATCCGCAAACACTCGCTGGGGGCACTTGTCATAAGGCTTATCTGGCGTGGAAACTCAAGTACGAATTCAAGACCAAGTCTGAGACTGAA
ATTGAGACTGAGACCGAGACTGAACCGGCAGAGGATGAAACAGCCGAAGAAACCACAAAACAAACCGTCATTCATATTGAAAGAGAAGATGATTTAAGTC
GCAAAGAACAGCTATCGTCGCCAATTTGGAACTGTAGCCATCTACAAAAAGATTATAAGCTATTATTACAAGCGCGCATTTGGTGATCCAAAAGAATTCT
TGAATAAAATCATCATCGAGGACAAAATGTATCAGATATGTAGTCAGTCAGATCACAAAGGATTCTTACACTTCATAAAAGACGTAGCCCATCCTTATTT
TCCATTTATGAAGATAGATTATGACTACATGGGCTTCAAAAACAGTATATTGCTTTAAGGATGCTACATTCATCGCGCCTGAATCTGTGCCAATTGGAAT
ACAAATTCGAATCTGTCACGATTTCGACTTTGATATTCTCGAGGAAACATCGCTTTTGAATACGTTCTTTGATTATCAGTTTGATACCGAAACAACTGAA
TTCATTAACTTCATGCTGGGCCGCGCACTAACTAAGATCAGAGACAAGTTCGATTTCATGGTGATGCTTGTCGGAGTTGGCGGAGCCGGCAAATCTTTGC
TAGTAAATTTGCTTTGCGAGGCTTACGGATCAGCGCAAGTTGGTATTCTGGGGAGCTCATTTCAAGACCGTTTTGGTTTGTGTGAATTTGCTAAAAAAAA
AAAAAACAGATTGTTACATCAGATGATATGTCTCGTAACATTGCCAAGATTTTGCCGAAATCCGATTTTCTGTCCATGCAGAGCCGAGGTAGAATCTCTT
GTCCCGTGAAAAGCAAACACTTGATTGAAGTTGAATCTTGGATATACCGACTGTAATCAATAGCAACGAGCTTCTCGATTACAGCGATACATTGGGTGAG
ATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCGATGTACTGGTGGCACAAGTTGTACCAACGGGTGGGCACCTATGTACGCACGT
GTGAGACGTGTCAACGGACGAAGTCCACGCCGAACGCGGAGGCGCCATTGGCGAGTTTACCGGACCCCACGGGATGTTGGCAGTCCATCAGTATGGACTT
TGTGTTTGGCCTTCCGAAAGACAAGGCGGGAAACACTGTTATCGTGGTCTTTGTAGACCTGTTGAGCAAGATGGCTCACTTAGCGGCAGTGCCGGACACC
ATCGATGGTGAGGGTACAGCTTTGCTGTTTCTAGACAGAGTATTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATAGAGACCCGCAGTTCACCG
CGAAATTCTGGACGTCCTTGTTTAAGTTGCTTGGCACGCGTTTGGAGATGTCAACAGCGGATCATCCACAGACCGATGGTCAAACTGAACGCGTTACCCG
CGTTGTGGAGGACATCCTCCGAAGCGATTGCGCTGAAGCGTCAAAACGCTGGAGCGCGATACTCCCACTCGTTGAGTTTGCATTGAATAATGCGGTACAT
GCCTCTACAGGCTTCACTCCGTTCTATGTGAACGGCCTTGTGAATCCTCGCGTCCCGCTGTCGCCGCCACGTAGTGGCTCAAGGCTTGACGGGGAATAGC
CGAGCGGCTTGCTGATGCCAGCCCTCTTGCGGTACGCATGCAAGTCGATGACTTGTCTCGGTGAGAATTAGCGTTATGCGCCAGGTGCGCGACGCTATGG
CTGAGAGCCAAGACCTGCAAAAGGAGCATGCGGATGCTCGAAGCAGAAAGAATATGGAACGGTTTAAGATCGGAGATCTTGTTTTATTAAATGCAAAAAA
CCTACCTACACACGCAGTGTCTGCCGTATTCTACAAAACTAAGACCTAGATTCATTGGACCGTTCAAGGCCGTGGCCAGCTAGGGCCTAGCGTACACGCT
AAATCTTCCCAAGAAGACGCGCACCCATCCGTTGTACGTTGGATTGCTCAAGCCGTACCAGGACCCGGCTCGTGTGAGCGCCGAGTCACTGGCGCCGAAC
CGGCAGAGAGCGGCTAGGCCGCGTGCGGCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTTGTGAAGTTTG
GAGTGTATGGCTTCAAGCTGGCTCGTAGATACAACCCGTACTGTACCGCCTTCTTCATAATATTCGTTTTCGTCCACATAGAGATCTCCAGCTGGTATTT
GCTCCAAGTTACTCTGAACACTGCCTTCCCATTCACTGCCAGCGCTGACATCACTAGGCTTTATCATTGCTAGTGCGGCCTCGAACAGCGATGCCATTGC
CTCAGGAGACCGTAAATTCCTTTCCACATCGTATACAGCTTCCGAAAGACGCTGAGATAGCCATCTTCTCGTTGCTAAATCACTTTTTTTTCTGTAAACC
TTTGGATAACATGGAAAGGATCCTGCTTAACTGCAAACTCCATCACCAAATATTCTTTTTACCAAATTTCTCAAACCATTCGCGTGATCACACACAGAAA
TTTGCTCAGTGTCTGGATTTCTTGCAAATTTTGCCCCTACCGGTTGCGAAATAACTGTGGTCTCTTCATGGTTTCCCGATTTGGTAAGCCGACGTGCCAT
TACTTGTCCTATTTCGTTCTGGACGAGCAGCAACATCCGAATTTCAGAATCTTGTCCTTTACTCCCATCCGAGCCAAATACGTTTAATTAACTGCGGAAC
TTTTGGGAGCGGTCCACCTTAGTGACCTTCGCACACTTCGATACAGACATGTGAGCATCAATTAACCTACTGCGCACTGTCGTTTGCGTGAGCCACACCT
TTTGAAGCACTTCGTTATCGAGACAAGCGTGTTCCTTCATATACTGCTCCACTGTTTGAAAGAGAGGAGGAGAGTAATTAGGCTCATTTAACTTGCATTT
TTCGATGACGGTAGCAGCGAGGGCCAACAATGTGTAGAATCTCTTTTGTCGACGGCGGGTTACATTGCTCACAGCGCCTGCTATACCCTTGGTAGTCAAC
ATACCATCGTAAACTAGATCAAAAAGCTCCAGTGAAATGCCAGACTGGTACGCAAAGATGTAACGAAACGCTAGAAGCACTTCTTTTGATGATGACAAGT
AGCGTTTATCAATCGTTGTAAAAGAGGTTTTTGAGGCTCCACGACAGCGGTATCTTGCGTAAAAAAAAAGTTCGGTCTTGTGATCCACATCGTGCACCGT
CCGAGACAAGTACTCTTTAACTTGAGGAGTACATTTGCATCCACCTACAACACAAATGGCCTTAAGGCTGACTAATACCTCTGGAGCCCACGCAAGAGTA
GGTACCTTAAATCATGCAGATAGAAGTTCGCCTCCTTCTTGCTCTGGCTTTGTTAACTGTGGTGGAAATTGTTTACGAGCTATCGCCTCCTGCACGACAG
TAGCGCCGCCATCTTGCTATACCAGTATCCTTCTAAAACCTTAAAATTTGTATTTCTTATTTCGCCAAGGTTTTCAATGATATTTATAGACAGAGGCGGT
GGCGCCCCGCCACCCTTCGGGTCGCGGAGGCTCCCGGGCCGCTAGTCCCGGGAATGCCAGATGAGCCGCGTGGCGAGGCAAAATTGACAATAATAAGCTC
AGAGTGAACCGCAATCGCTCCCATTACTGGATTCGGTGCACCAGTCCAAACTACAGATTCTCGGATCCATTTTTGTGGTACATTCAGGATAGGAATACCC
TTAGACAGATATAAATTGGGCCTCAAAGCGCTATGACTGCTGGCCAGTGGCGATTTAGATATTTATCAAAATCTAAATTATGAATATTTACGCTTTTACA
TAAACTGGAATATATTAATCCCCCACCGAGCGAAGTGAGGCGGCGTATGCTCTTGCTCGGCTTCAACCTGCGTAAGAGCCCTACTTGCGGGGCTCCGCGT
GGCTTGTATTGTAAATTACGAGCTTAACCTATTGTGTGATACTGACCTGCTGTAGTTACAGACGATCCCCTCGCTGAAATTACGTACAATGTACTCCCAT
GCTTATGCTTCGAAGTCAACTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN