Description :
From Genome Similarity Track
Location :
Scaffold_48:226346- 231756
Sequence
5410 bases(100 bases per row)
AGGCTATCTTTTCCCGTTCATCGTCAACTTCATTCTGGATGAACTTGGCGATGGTGGTGTGTTGTATGTCTGGCCTTAGAGCGGACAGAATTGCGCTGAC
AGTTTCTTGCCCTATCGTCAAACTCAATCGTTCGACGGCATCCTTTTAGAAATGAATCAAATAAGAGTCGCTCTCGTGCGTGGGACGGAATTCCTCCGGT
TCAGCATCCAACATTTTCATGGCAGTCGGATGGACTACCAAGTGCTACCAGGTGTAACGGGGCACCGATCGCTTGTACTGTCACAGTACAAGCTGCTTAT
TCTGAACACAGGTTAAGCAGGTGGTTTTTTATCTCACATACATGTGCGTGCAGAGGATGGTTTCAATACGAGACAAGGGTAAAAAGTAGAAGTGTTCTTT
AGTATAGTTAATCTCCTGTTAATAAATCCTATTCAGAATTCTTTTAACTATACCTAAATACAAACATGTATTGTAACTATCTATTCACCACTCATTGCGG
TCCTCTGTCGTGGATCGTCTATATTGGGTGATTTTATTGTTATATATCAACCAATGAACAGTGTATTGCGAGCCCGGAAGTTGAAGCTATTAGTGACTGT
GCGCAAGGTGAATGCCGAACTTTGTAAATCGTACTTATCTGTGTGTTTCTGTTCGTAACAAACGCTAAGTGTACCATAAACGTCGTACTAAGTACGATTT
GGCCTTACTATTCCTCTGTATATGAATAATGTAGGTGTACCTTACACGTCGTACTAAGTGAGATATGACCTGTCACATATCGTGTATATCAATAACACAA
GGTGCAAATTTTGCTTCGTATTAAGTGCGATGTAGCCTGTCGCCTTTTTAGCATGTGTCTGCAAACAAACGGCAGGTGTACCTTACACGTATCTTTCTAA
GTGCGAAGTAACCGATCCCAGGGGTGTAGTGGTACAGTATTAATACTGCGACCGGGATGTATCCTGATCGATACCAGTGGTGGGAGCTTTCAATTACAGG
ACGCCGGAGATAGTCTAATATGTAGAAGTGCAACCACCAAAGGGTGGCCGCCTTGACAACTCTCGACCCAGGGTGTGGATAGTTGGGTGGGCTGGAGGCC
GTACAAGCCGAAAAGCCTTATAGTGTAATGAGGGGTGCGGGCTTCTAACGAGGAACCGCGTCACTGAACCCTCAGATCACCTTCGGGTGGTCTGAGGAAG
CTGCCCGGAATAAATCTTTAAGTGCGATGTATCATTCATCCCTTCTTCATTGATTATAGGCATTTTTGCGAGCCTGAAGGGTGAAGGTGGTAGTAACTGA
GCGCAAAGGGACGTGAACATACGAACTTGATTCATTTCTATGGACTGAATTACTGATATTAAAGGGCGAGCTTCAGAGCTTGCTCCCCTATCTTAGGTGA
TACTTTTGTTTCTTATGCATTTGATTATGGAAGGCATTAAGTATCCACCCCCTCACAATAAATATCCACCCCCTCACACTTACGATGCTCTGATTGGTCA
ATAAAAAAGATGCAACGATCATTTTAATCCCTGATTGGTCAGACAAGGAATGAAAACGAACACTTTTCAACCAACAGCAGGTACATACGATTGCTCACCT
TCCTCTTGAACTGTGCCCAGCCAGGGCATAATGCTTGTACATGCCATGCAGTTATCGATACAGATATAGAAGTAATTGACAGTACGAAATAGCAGATGTT
TAATTAACTTTCTAGAGTACCTGCTGCGCCAATGATATATACCTATGGACTTGAATGGGTGTCTTCTCAATGTGCTTGTTTAAAAAGAGAAAGGGAAACG
GTCTATTATAGCTTCTTATCACTACTAAGATGTTTGGTAGATAACAGCTCGTTTCTTACTTCTCGCTTTCTCATTCTGTTAGTTAAAGAGTCATACTTCA
CTATTGGTAACTCCTACAAGGGCCCGTGGATCAGTTCGTTGACCAAGTCTAGGGTTAGGTTTTGGTGTGCACTTTAAACCGAATGAATGGGCTGCCCTTT
CGCTCTTGATGAAATTATATATTTAGGAGACAGCGGATGCTTGACTAGGATTTTAATTACCATCGCGGTAGTGCCAGTGAGTCATCATGACTTAATTCCT
GGCCTTCACCTCGTAGTCGACTTACTTAGCTCTCCAGGTCGGATCTTGAGGTCCACAATGAGTCAAAATTGGTTAGATGCACCACTGGAAGAAGCGTATC
TGGTCATGTGCTACTGAACATGAACAACCGGCACTGGATCTCAACAGTGTCATCACGGGTTTAAGGGAATTCTCTTCGTGGGACCTGGCTCAAGCTTAGC
GAAGGGGCCGGCGGTTTAGTTTACCCGTTACAATATTTCAGGGATTGTTTAATGCACTTCTTTTTATTGGACAACCAGATCAACGTAAATGTGAGGGGGT
GGATAGGTATCGCGAGAAAGGGAAGCTTAGCGCCTCCCTTGATTACATAGTAAGTAATGTGCCCTTAATAAATTCAGACAGTTCGACTGGGTTTGTACTT
ATCAAAGGGTGGGTGCATTTAATTTTTCTAAATTAACTTGAAGCATAGTCGAGTTAGGTAATATAGAGTACTGATATTTTCACCCCCATTTTACTATTTC
TACCCATCTAAAACTAAAACCGGGTTTTTTTATAATGAAGACCGGTCTACAAGGTCACGCGCCGCATGGTTACCAATGTACAAACTGTCCAGAAGATGGA
TAATACTATCGGTTAGAGCTGACCAATACGAGCTCAGTTTTCCTCAGAAAGAGGAAGCTGATGAAGAGCATGGATCTGGTCGATAGATTGAGGATTTGCA
ACAATTAGGCTGCAGATATGGCCATTTGCGTCATGCCTGAGATCATAGCGGTCGTGTTTCACTTGGAGCTCGTCGAACAGCGCTTGAATCTGCATTCCTT
CATTTTACTTACTCTTGTGTCCCTTTGGATTGTAACCGTATAAGTCCCGGCTCACGCCGTAGTAGTCCGGATACTCCTGTAGTACGGAAGCTATTTTCTC
TATTGGCCGCACACCTGCTCTCTCATCCTCAATTATTAGTCATGTATCATGAGTATACATGTCCAGGTTTTGTACATATCATGGTTGTTCACCACTTCAT
GTTAAGTCACCTTCCACAGCTCGGAGATCGGAGACATCGATCTGTCGAGGTATGAGTCTATGCTCGCATTATGTGCTTTTTGTATTTGTCGTTCGGTTGA
TAGCAACTGATTTCTATGATCGCGCTCGATCGCACACAACTATCGTTTCCCTGTAGTCGTACCTGAAGATCAAAGGTGTAGAAATCAAGCGTTCGCGCTT
CTAATTGAAAAGCCACGAAGTAACCGGTTGTTAACTTCGAAAAAATTACAAGGCTTCATCGATTTTATGCAGATCCTTTAAAGAGCTGTAGTTTAATGGC
GTGAGTGGTGGTGCGTAGGACCGATCGATATAGTTTTTAGGGAATATTACAAATGGTGACACGACTTAAATGTTTCACGAGAATGTGGTTAAGCAAATCT
ATATCGGGAGGATAAAACCTCGTCTTCCGGCTAAGTATTAAGCGGTATCTAGTTGAAGCATTGTGGAAAGATGGCCGTTAACACAGATGTCACCATTGTA
TGACTCAACGGGCAGATCCCCGTCCATCAGCGCCGTCCTAGACTGTGGAAAGAGGATGGAGAGCGATCAAAAGCCGCTATCAGTGTACCGCGATCAGTAG
ACCACAATCAAGGGACCACAATCAGGGGACCACGATCAACGGACCACGATCAGGGAACCGCTATCCAGGGTGGGCAACCTCGGAAGGGAGGCTACACGTG
ACAGTATATCCTGGCCTATGGGGTAGGCATAGTCATAGTTTTAGTCTTTGGTTGGTTAACATTAAACAGAGTTCAATTTGCTTCTAAACACATTCGTGTC
ATTTTTCTCCCAAGCAGGTTATTTGACTTCCCGACGTCAGAGAACTTCGACACTACTAACTGGAAGATCACTCCTAGAGCTATTTGGTCAGGCTTGCAAG
GACTCTCAACAACCCTCAAATGCGATCAATCCGTCTCGTGATCTTGCAGTTCAACCAGTCAGGCAACCTGACTGGTTGAACTACAAGATCGCGAGACGGC
TCAAGTGGTCAGAAGGCTCGCGACTCGAGTACCCCATTTTTGGCGAAAGGCGATTTAGGCTGATCGCGGCGACTCTGGGAGAGCGCCAACCAAGAACACG
CGATCTGGTGTGGAATTCCACCCGATCGACGCCAATCTCTAGTATGGTCAAGTTTAGCATCGAGTCAAGTCCACCTAGGAGTGCAGCCAGCCTTACTGAC
GGGTACACAAGGTGAGGAAAGAACAAGTGCAAGCGTAATCGGAGTATTCTCTGCGTTAGTCGGTAGTCTGGGCGCCTGTGGGAAGTTAGGATCGCCTCAA
AAATGAGCGAACCCCACTCCACCACAATGGTGCGTGTGCCCGGATCTTCTTGTGACTAGGGATTTCACTGTGTCGAGTCCTGTGATGAAGATGTTGAGAT
CAAGACCGAACCTGGTATTTAAGATCCAGCGGAAGATGGATCGCCGCAGACGCGCGAAGAAAAAGATTTTAAGATCATCAGAGTTCTGGATGGGACTATA
ATGACAAGAAATTTAAAGAGGAAGATCACCAGGACGATCGGGAAGAAAACCCTCTAACCCCTCCTGAGGTCCCTTCGGGGACACCCGCAGACCATGTTAC
AAAACATGGTCTCCCGGACGAAAGTCCTTCAGTCAAAACTGAAAGATTTTCAACCAAAACTACCCTTCAATCAAAAGCGAAGAACATACTCCTAAGCTAT
ACCGATCAAAGACGAAGATAGCAGAGCCATATCGAAACAATCAAGCGATCAAGACGGAAGGTCAAGACACGGAATCAGAAGGCTGGCAGCTGGAATGGAT
CACCTGGGAATTCCATTGGCAACAACTAAAGAAACAGCTCGCGGAAGACCCAGTTCTAAAGGTGTTGAAGCCTAAGCTGATCGGGTCGATACATGGCCCG
GTATAACCACCAAAAGTGACCTAGAATCAGCTGGAGGCACTGCGTCGTCTTATCCAGTTGCTGTGAGACGCCAGATTTACGGCCGGAGCGTTCGATGCAG
AAACACTCTTAAAGTGCAATTACGATCGGGTGATCAAGGCAGGGAGGCTACTATTCGAGAAGCTAATTCCACTAACGGGATCTCACGATTCTGCGGATCA
ACAGATTAAGAAAGAGGAGAATACGGACAGAGGGATTAAGCAGATCGACCGTATCCCGAAAGAAGAACACCTGGTCCAAGTGATCGAGCTGGTCTACCGC
ATCGTGAAAGAAGAAAATGCAGGGTCATCGCGCTATGCCTCGGCAGAATCAGATTTGGACTCAGACGAATCGTTTGGAATGCAGCGGATGTCTCTGGGGC
CGACGGGGGC