Description :
From Genome Similarity Track
Location :
Scaffold_757:2263- 4200
Transcript NameFunction/comments
Phyag_g7874hypothetical protein PHYSODRAFT_346079

Sequence
1937 bases(100 bases per row)
ACCATCCGCGACATTGCGCGCCTGGCGGGGGAAGTGTCCGATGAAGCCATGCCCATTTGCAACGTGTTCGAGGCCGACGGCGCCAACGACATGTGCACAC
TCAACCACCTGCACGAGCCGgccgtgctcaagaacctggagctgcgcttcgccaagaagatgccGTACACGTACACGGGCGCCATTTGCATTGCTGTGAA
CCCGTACCAGTGGCTGGATCTGTACGGGCGAGAGCTATACGAGCAGTACCTGGAGCAGCCGAGAGACTCGCTGCCCCCTCACCCTTTTGCACTCTCAGCT
ACGGCCTATCTGGACATGAAGAGGACCGTAGTGGACCAGAGTATCTTGGTGAGTGGCGAGTCGGGAGCcggcaagacggagacggtTAAGATCATGATGA
ACCACTTGGCGTCCATCTCCGGAGGAGGCAACCACGGCACGAAAGTGATCGACCAAGTGCTGAAGTCCAATCCGTTGCTGGAGTCGTTCGGTAATGCAAA
GACGAAGCGCAACGACAACTCCAGTCGGTTCGGTAAATTCGCCCAACTGCAGTTTGACTCGATGGGGTCGTTGGTGGGCTGTCTGTGTGAGACGTACTTG
CTCGAGAAAAGTCGAGTGGTCGGGCAGACGGAGGGAGAACGCAATTACCATATTTTCTACCAGATCTTCTGCTTGCCGGAGGACAGGAAGActgagttga
agttgagtgGTGATGTTACGAGTTACAAGTACGTGACGGAAGGAGCACATGCCGGAATTGATGATGTTCAGACGTTGAAGGAGACACAGGATGCACTGGA
TACTATCGGTATCTCGACGGAGGAGCAGAACGGCATCTTTGAGATTGTGGCGGCTATTCTGAACCTTGGTGAGGTCGAGTTTGAGCAGAACGGCAACGAC
AGTGAGAAGTGCCATGTGAGTAATGAGGATATTGTGGACAATGTCGGCGCTCTGCTGCGTACTGAGAGtgcggcgctgcactcgacgttgctggagcgTT
CGATTACGGCCGGTTCTGAGTCGTACACGATCCCCCTGAATGCCGAGCAGGCCTCAGACCTGCGCGACGCGTTGGCCAAGGGCATGTACACGCAATTGTT
CGACTGGCTGGTGCACCGTATCAACAAGGCTATTTGCTCGACGAACAATGTGAAGACGCACATTGGTCTGCTAGATATTTTCGGCTTCGAGAGCTTTGAC
CAGAACGGCTTCGAGCAGCTGTGCATTAACTACGCGAAcgaaaaactgcagcagaagtttAACAGCGACGTGTTCAAGGATGTGCAGCAGGAGTACGTGG
ATGAAGGCATCCCGTTGACCTTGGTGACGTTCGAGGACAACCAGCCTATTCTCGACTTGATCGAGGGCCGGATGGGTATCGTCAGCATGCTGAATGAGGA
AGTGCTTCGCCCCCAGGCTACGGACAGCACGTTCGTGAGCAAGGTTCTTGATGCTTGCACCAACCACCCTAGCATCGAGAAGAACAGGATTAACCCGCTG
GAGTTTACCATCCACCACTACGCCGGTGATGTGACGTACAACGGTACGGGCTTTTTGGAAAAGAACAAGGATACACTGCCGACGGACatggtgcagctgc
tgtcTGGCAGCCAGAACGATGTTATCTCGGGCATCTTCACGCCTACGCAGAAGGGCAAGCGTAACAGCCGCGGCAAGAACGGCAAGGAGGGCCGCCAAAA
GGGTTTCCTGGTGGGTAACACTATCGCGGGTGCCTTCCGTAAGCAGCTTTCGGAACTGATGGAGACCATCAATAAGACTTCATCGCAGTACGTGCGCTGC
ATCAAGCCTAACGCCAACAAGAGCGCTGTGGAGTTCAACCGCCTCATGATTGTGGAGCAGCTTCGTTGCGCTGGTGTGATTGCTGCGATTCGCATCAGTC
GTGCGGCTTTCCCTAACCGTTTGCCGCTCACTgagtt