Description :
From Genome Similarity Track
Location :
Scaffold_41:226218- 227578
Transcript NameFunction/comments
g12637.t1OWZ19624.1 hypothetical protein PHMEG_0006094 [Phytophthora megakarya

Sequence
1360 bases(100 bases per row)
CAGAGTCACAATAGTTGCGAAGAGAAGCGTTACCACAATGGTCACCTTGCCTGCACCAGCAGGCACAGAGTCGTCCGAGGTCAGGGTGTCCACGGATTCG
CGTTTTGAAGACGTGATTGAGGAGCTGCTTTCGCTCGAATCCACGGTTGTGTTTTCAAAAGTGACCTCCGCATAATCTTGCGAGCCGCTGCTTGAATCTT
GAGCGTGCACACCAGCCAAACTGCCATCGCCACTTTTCAGCCCCGAAAACGTAGCGGTGGCACCCGATTTGTATCTGACAGTATCGTTTGCAGGTTTCGC
AGTCGCAGCAGTAACGGCAGCAGTCGTCGGTGCTGCAGTGTTGGTGACGCTATCACTCGACGTCACCTCCACCTCGAAGCATGTCGAATACGCGGCACCA
AAATATCCCTTCGCTTGAGCTTGATCGACGTACGAAGTCTCGTTGTCCAACCAAAACGTCCAATACCACACCATGTTGTAGATGCCTGGGGCGGTCCCCG
CCGGAACGACAAATGAACCAATGCACGGCTTGCCGTCACCCGCGCGGCCACCTGGATTTCCATAGGAGTCGACTGTCTCGCCGCAGTTCCCGTCGTCGTA
GTCCGTGGTGTGTCCGTCCAGCAGGTGCTCCGGGGTCATATCAAGAGTCGTTGTCAAGGAGGTGCCGGCCACTCCCGTCCAGTAGACTCCATGCTGCGTT
CCAATAGCCTTCTTGTCCTTGACGATGTGGCCGTTTGGCAGGTACGCGAAGTACGCGGTCTGACCCGGAGCCACCGAAAGACGCTTTCGCCAGTCACTGT
ACGTGTTCGCATCGGCCGACTGGCAAACGGTGGTGCCGGCCTCGACCTCGTTCTTCAGCATCTTGTACGTGTAGACCGTGCCAATGTCGATATCACCACG
ACCGGGGTACCCTGCTCCGTAGCCCTCGCAAAATCCGTTGCCACCTGCACCACCAAAGATGTACGACGCGCTCTGATCGTAGAGTTTGGATCGGTCTGTG
TCGAAGCAGTCAATCCACGTGTGGGCTTCGGCATAGCGCGACCAAAGCAGCAGGAACGGCACGACGAAGCTCAGCAGCAGCATCTTGGTCATCGCTCGGT
CGGTGCAAAAGTGCGGTGGCCAAAGCACGGCAAGAAATATTCAGGCAAAGGCGCGGCATCGCTACACGGACCAGCTGATAGGCGGCAGTGCACCATTCAA
CAAACTTTATTGCTAAGATCCACAAGTGGACACAATTGTCCACTGCTCTAACAAAATATCTGTACTAATCTACCATGTTCATGCTCTTAAATACGATCTT
ACCCTTTACAAAAATGCCTGCACTAAAAAGGTCGGAAGAAAAACAACTCAACACTTCAGC