Description :
From Genome Similarity Track
Location :
Scaffold_25:22621- 23901
Sequence
1280 bases(100 bases per row)
TATCAGCACCTCCACTTCGAATCTGCATGTTTCGCTCCACGGTGGTGTCGCCTTGTTTTCACACCGATTCTGCCTGGAGTACGCGGCTCGCCAAACATCG
TCCAGTGTTGTTGATCCTCTCCCTCAACCCACAGAAGGTCATAGTCCATTGAATCCTGGGCTGTGATTGCTGCAAGTAGTGAGGTCAAACCACAGAAACC
GCTCAGTATCGTCGATGCACTCTCAAAAATGGACCAGAATGGTTTGAAAGACGATGCGCTGGCAACTCGACTTCGAGTAAGGGAGACAGATTTACTTGCG
TTGGAATCCTCTTCATCTTCGTCTTCGCTATCCAAGCCCAGCCCAGCTGATATCACCTGCTGCAAAGTTGCAAAGAGTGTATCGCACTCGCCGAACGTTT
TGCGTGGTTTGTGTGGAGACAATTCCCGCTTTGCATTATCTTCGCGAGCATCGACATCACTCTCCAATTCATCGGAGGTATCTGATACGCTGTCTTCTTC
GGAGATATTGGTCGAGGATCCAGCTGAATAAATGCCTCTGTCCACAGCAATGAACCCTGGAGATACCGACGCGACCCCACCATTACGGCGAAGCTGAACG
CTGTTACCTCTTGGCTCAGGCTGGTCGCTATGCTCCTCCGAATCACTTTTGCTGTCTCTTCTGTTGGACACTCGTATTTGGACTACTCTTTTCTTCTCCC
CTTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGCTTCGTCCACGCGGCGCCT
TTTCCTCTGTATTTCCTCCGGGGAAATAGTCTTGGACGTGGCAACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGATTTGACGCTCGAGTTCCCC
CCCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGCCCTCTTGTTGGTCACGTG
GAGGGCTCTGAGAATCTTGAACCAATCGAAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAGCTCCCTCACACCCACGTC
TGGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCCGCTGTAGCGGGCCACACA
GCCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCAT