Description :
From Genome Similarity Track
Location :
Scaffold_71:2262- 3888
Sequence
1626 bases(100 bases per row)
CCCAAGTTGGCTCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGTTCCGTGCTCGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCTC
GACTTCAAATTCACCGGCAACTTGATCTGGTTCCCAGCTATCTTCAGGCAACAGTTCTTCATCGAAGTCGAGTCTTGCTTCAGTAGTCGCGTCTAGTACC
AACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCCA
GCTCGTACGCAAACTCTTCCACCTTGCGCTTAATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGAAGGGTTCGCCAAGTGTTCG
TTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTAAAGCCTGATAATCTTTGG
CCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGC
CCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCC
GCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCAACGAGCGTTCCTGCTGTCCATTAGCCTGTG
GCCGATAGTTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAAGGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTATTAA
CGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTTAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTG
AACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTACGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTA
GTACGTTGCCAGGCGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCC
AATCCAATTATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCACCTTCCAGCGAGTCGTGACAGTTATGTAGGACCTCTTGAATC
ATCGTTGTCGGTACTACTAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGATA
GCACGAATCGGTCAGCGTACTTCCAGGCATATCGAGCTTCTCTATAACTTAGCTCTTCTGCTTGGCCCTGCAGCACCTTCTTGATGTTAGACCACTTCTG
CTCTTCGTCTTGTGCCACCATTATCC