Description :
From Genome Similarity Track
Location :
contig_136:22611- 24100
Transcript NameFunction/comments
g11614.t1hypothetical protein
g11615.t1hypothetical protein

Sequence
1489 bases(100 bases per row)
TTCTGGCAGAGGTGGGGTCATGACTCACCAATGCTCTGCCAGAAGCTGGGTGCCGGTTAGCCTCGATGGCTTTCCGACACCAATTGCTTCAGGGTGCGTG
CGTCCTTAACACGGCGTACCCAAGCGGACGCCGTACGTGTCCACGACCACGTACGGGTCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCTATGCAG
ACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCGGCGTACGAAATCATTCGACGCCCCTGGAACTAAACGTTCCTAGGGATATTAACA
TCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATCACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGCGTCACC
CGCACACCCGTCACGAGACTCAACTCTCCCCCCTCTGGGGAACCCGCCATTACTGGTGGCCGGAGTTCCCTCGGCCACCTGGCCGCGGCTTGCGCCAGCG
ACCGTTAGGCCCTCGGGGTTTGAGGGATGGTTCTTCCCCACCCCAGTCGAAGGACACACACGTTGGTAGTGTCCTAGTCCGCCGCATTTATAGCAGCGGA
CCGAGCCAAGCTCAGCAGAGCTCAAGTCCATAGGCTCTGACTCGTTGTTCGCAACGACAAGTTGCACAACAACCGGAGTACCAGCCTGCTTATGGCTGTA
CTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATGCATGCACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCACCGTCGTCT
TGACGTCTTCGGGCAGGGGGTTCCCCACCAACGATGATGCTAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGCTTCCCTTGCTTACAGGCGAG
GAAGCGTGAGCGCTGGCGGAACGTATCGTTCGCCGGGAGAAAAGCAGCGCGAAGCCGCTCGTACAACTGTTCCCAGTATGCAAAGCATCCAGGAGACGTC
GTCTCCAGCGTGTACGCCCAATTCTTGGCACGACCGCTTAGGTTGGACAACGCGAACGCAACGCGAAGTCCCTGATCCGAGATGAGACCCGCCCTCATGC
GATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCACCTTCCTTCCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTTCGGCTGGACCGGCTTCGGC
TCGGCCACAGAGGCCTGCAGGTTCCCTGCACGTGAGCAATGAGCTCACGCTCATACGTGTCGAACGCGTGAACGCGTTCGACTTGCTCGGCTGGCGTCAC
CGACGCCAAGCCTCGGAGGACATCCCTCCCAAAGATGCCTCCTATCTTTCGAACGGACTCGAACTGCGAGTCGTTCAAGTGAGGAAACTCACTTCGTTCC
ATAGTGGCTCAGGCTTTGAGACCACAGAGGATTCAGGTAGTCCAATCCTACCCGCGTAGGCGTGGATTGACTACAAGTGCTACCAAGTG