Description :
From Genome Similarity Track
Location :
Scaffold_577:2261- 3960
Sequence
1699 bases(100 bases per row)
ATAGCCACTGAACGGAGTACGTGCCGTCCTGCTTTCATCATTGAATTCAGAGTCAAGTAACTCAGACATTCCGATGTCCAGCACACTAGCTGCCTCAGTC
ACTGGCTCACGCCAATAGCACTTTTGTTGTCTAGCAAAGGTGGGTTCATGACTCTCCAAATCATCGCTAGAAACATTGCGCGTTGCGCCTAAGATCTTGA
ATCTCCAATCAATCCATGGCTCGTTGCGTTCCAGTCAGACCATAACGAGAATAAGATCATATCTCGAGGCCAAATCTAGGTCAAGACAGCGTTCAATGCT
GCCAAAGTCTAAAACCTTTACACCTAAGTTTAACAGAACGTCTGGGACGGTGAATTGGGCTCCAGTTGCTAGACGGACCGTGATAAAATCACCGTCGTGC
GCATTCAGCGCCTCAGCACACCGCTGAATCCCTTCAAGGGACAGCGTCGGACGTAGTTGCAACAAGCCTAGCTTGTATTCACGCTTCGTGGTAACGTCCA
CGAGATCGTTTGGGGCTAAGCCCTGATCAACTGTACCTCCTAGAGCCTTTACAAAGCCATTTTCGTTTCCACTAGGGCGTCCCGTGCCTACTAAGAGTCG
ATATTTTCCGCTTCGTACCAGGTTTCCGGTTTGGAGAGGTATTACGGTTCGGTCGATTCTGTCGCGGTTTACGCAGTGGACAGTTAGGGAAGACATGCCT
TGTGCTTCCACACGTGTGATATTTACGGATATTACGTTGCTGTTCCAAAGATTGAAGCTCGGCTTCTTCATCGTCCGCATGACTGAGATCCATGGGCTCA
GCCCTAGCGAATGAATTATGGGCATGCCCGTGTGTACCGTAGTGGGCCGCTTTAAAGATAAACTCGGCGTTTAACGCTATGTGCGCCTCCTCTTTAAAGG
TTGAGGGATGGCCACGTAAAACTTCTGTCCGAGCGACCCAGTACGGAGATCTTCCATAGATAAAAAAGGTTACATAGACTTCCTCGAGGAAAGTATTCAA
CTGCATAGTAGCGAGAATAGTTCTCAACTCTTGGCCATAGCCTGACAACTCCTTTTTTCCTTGTCAGAAATACAAGAAGCGTGAACCCACTCGATATTCC
TGATTAGGCAGTGCGAACACGGGAGACAGCTGTCTCTTAAGTGACTCCCACGTGGAAACGCGCGTCTACAGACGCATCACACGTCAGAGACCATTCTATG
GCCCTGCCGTTAATTTGATATGGCCAGGTTAACTCTCTGCTGCTCGGTTCGCAGCATAGCGGCGCTCATCATCATTTCGACTTCTTGAATCCATAAAAGG
AGATTTTCTCCCTCTTTCTCCTCAAATGTCGTTACGATGAGAACGCGAGCGAGCCCTAGGCTCCTCATCGGGCATAGGGATGTAGCGTGTTCGCATAGCG
GGCTCCACATGATTATGGACCGGTCCAGTACCGTGGCGTCAAATCGAATAAAGGCTTCCAGTCGCACATTGAGCACTTCCGGGCCTGGTGCCAAAATATC
TTCTATTTGTTCAATCCCAATCCACGCTTTAAGTGTATCACGCGCGAAGCGTTGTGCCTCAGAGAGATGAGCTAGGCTTTCCATCTTAACAGATAATTAG
TCCTACTGGGAATATGGTGTAGAGATGACTACAAGTGCTACCAAGCGTAGAGGGGCTCCCCTGCTCTTAGTCAGAGGAAGACTTACGACTCTAGAAGTC