Description :
From Genome Similarity Track
Location :
Scaffold_4:22607- 43463
Transcript NameFunction/comments
g3534.t1hypothetical protein
g3535.t1hypothetical protein
g3536.t1ETL94824.1 hypothetical protein L917_07298 [Phytophthora parasitica
g3537.t1KUG01670.1 Exocyst complex component SEC3A [Phytophthora nicotianae
g3538.t1KUG01573.1 hypothetical protein AM587_10008029 [Phytophthora nicotianae
g3539.t1XP_008899025.1 hypothetical protein PPTG_06735 [Phytophthora parasitica INRA-310

Sequence
20856 bases(100 bases per row)
TGCAATTGATTAACCCTTGCACTTGCTCAATAACAATTCGGGAGTCACCGACCACGAATAGATCTTCGACATGATGTTCGAAAGCCATCGTCATACCTTT
CAGAAGTCCGTAGTACTCAGCGTCATTCACAGTAACATCTTTTAGAATATAACCATGTGCTTCTAGAACGGTCCAACCGGGCACCTTCCAAAGGATGCAC
CCGCAGCTTCCTTGACGAGTCGATGTCTTGGCAGATCCATCGAAGCTAAGGACGATTCCATCGTAATCTGCATCCAACATCTCAACACTCACCACAGGCG
GCTGCCGGATCTCACCTTTCGCTGGAATCAATGATTCAGCAACTTGGTCTAAGTGTTCACGCGGAGTGATCCCAGCGCCCATGATAGCAGCCAGACCATC
CTCGTCCCGTTGAACCTTCCGGATTTCCATGTTCCACCCGGATAACGCGAGTCCCCATGGGACGCATCTTCCGTCGGCGGATTTGGAAGTGATGACCCAC
TTCAGAACGGAGTATCTCGTATAGACGATCAGTGGACAATGTTCAACAATCGTCCGGAACACCTGAAGCACCCTCATGATAGCGATCACCTCTTTCTCGG
CGACATGATACCTCACTTCGGAGTCGTTCAGGACGCGGCCGGTATACCTGACCGGGTGTATCTTCCCATCATATTCCTGCCCGAGGACTGCACATGCGGC
CCACTGATTGGCATGCGGGATGATGACGAACGGTCGGGAGCGATCCGGATGGCGTAGCAACGGAGTTGAGACAATCTTCCGCTTCAGGATTCCAAAGGCC
TCCTTAGCTCTTGACAGATTACGTCCTGAGCGCACTTGGTCATCCGAGAGTTCATACAGCACCGCAGCTACCACTGGAAAGTCCTCAATAAACTTGTGAT
AATAATTGAGACTTCCGAGGAACGATTGTACCCCTTTCAGTGTGCTTGGGAACGGCAAGTCCTGAACGCCTTTCGCAATCTTAGGTGTCGCTCGGATGCC
TTCAGCACTGATCTCGTGCGACAGATACGGGATCGACTTCTTTCCGAACTCACTTTTAGGGAGGCTCACGGAAATATTCCAGTACCTCAACCTGAAAAGG
AGTGCGTTCAGATCATCACAAAGTTGGTCCCAGGTTTCAGCTCCATGTGCAATGTCGTCGATATAGGAACTACGTCCCAAGACAGGGCCCATCTGAGATG
GCGCAGGGATATTCCTTTTGAACACCGTCATGTACTCAGTCAGCGTCGGGACTTCAGGATTAGTGTCCACATCCAGAAGATTGGCTGCCGGAGGGGGCAA
CTTCAGGAAATCCAAGACGTCTTGGTCGACTTCAGCTTCTTCCTCTGGAGGCAGCCGGACGAATCCCCACAGGCAGTTATTGATTACTGCCTGATACACT
AAAGGCGCGTTTTTGAGTCCAAACGGCATTCGCACCCATTGGAAGTGTCCAAACGGACACACAAAAGCCGAAATCAACTTGGCACGCTCTGACATTCGAA
CCGCCCAGAATCCACTAGCCATATCCAAGCTCATGAACCACATTGCGTTCTCAAATCCTAACAGTAAGTCGTCAATCAGTGGTAACGGGTAGTTCGAAAG
TTCGATAAAACCATTGACGATCCGGTAATCAATACACATCCGGATGTCTACACCGTTTTTCTTCAGGACAATCACGATCGGAGAGGACCATGGTGATTCG
GAAGGTTCGATCAATCCAGTTTCCAAGAGTTTCTTGAGTAACTCATAGACCTTGATAGCCAAATGAGGTGCGATGGATCGGGCGCGTTGTGCGACCGGCT
TGGCCGTCCCAACGTCCAAATCACAAATCACTCCTCTTGCCGGAGCAGGAGCGGCATTTCCATCACCCAGAAAAATAGAGCGGTGGTACTTCAGGATGGA
CCGAAGCTTCTGCTCTTCCAGAGGTGATGTCGTTTCCGAATCTCCCACATCAGCCGCATCAATATCACATGTCGGGCTCAGCTCTTGGAGTTCCGGAAGC
ATCGCCAGCTGATCACGCAATTGGGCTAACAAGTCACTTCCTTCATGGATGTACACAGCGGGTTCCAAATCCAGCTCTTCTGCGTTCAGACGCATGCACC
TCTCATACTCAATTTTCAACTTTTGGATTGGGGTAGAGAGCATGGCTTGGGTTTGCTGATCCCGGAGTTCGTCCAATCCTGACAAGTCACCAGACAATCG
TTCACATCATCAGCACCTTCATCCGGAAACTCTTCATTCAGACTAATCGAATCAAAGAATTCATCTCCGTCCGAATCCACGTCGTCCGTCAGAAGTTCTG
CGCCTTCCAAACGTTCTTCAACCCTTGGTATGACCTCCGACTCCCTTGGATGACATCCGTCGCCAGTATCTTCCGGACGTGGCACTTCCTCAACCTCAGG
GTCCTTTTTCAGCTTTACCGTGTCTTCTGCGATGACTTCATCTGGAAGAGTCTCCTCCACTTTCGGACGTAAGACACGAGGCAGCTCCTGAAGTTGCACC
ATGTGAACTTGGTCGCTTCCAGGAAGCGGTCGAACCAATAGCTTAGCCGGCCATGAGTATTCGGACTTCTGGACGCAAGGAGGTTCGGCGTCCCTCATCA
TCTGCTCAAATCGTTCAGAACGTAAACGCATCTGATTGGATTCGGTATTCTCATAGATGAGAGTCTGCCACTCCTGATACCTTCGGAGACCCGGGCGGAC
AAAACGTCCTGCCCTCGGGAAGAAGCCAAACTCGATGATCCGAGCAACCGGCGTCCGAGTGTCAATGCTAAGACACCTTCCGGAAATATTCACCACTTTG
ATGGCCACAGCCCACGATCTAGCAGCATAGATGATCTGGGTTACCCATCGGTCTCCCCGACCAGCCCATACCACATCACGTTGTGGATTGCTCTGTCCGT
AATGTATCCGGACGATAGCATGTTCACCTGGACGCAGGAAAAGCTCTTCACGCGGTCTCACCGGAAGGTCCAAACCTCTGTGGTAATGATCCGCACCACG
TCCTGATAGCAACACAGTTTCTTCATCCGGAAGTTGCACCAATCCTTCTCGTGCGCACAGTCGCACTCCAGCAGAATACATGAAATTCATTCCAAGCAAC
ACGTCGACACCTTCACCAATGTTCGCGACCCAAAGTTCCAAGACATACACAATTCTCGGACCCAAAGTGATTTTCACTTCAGCACTCGCGGTGATGATGG
TCGGAATGCCACCCAGTCCAGATACCCGGAGCTGTTTGCAGAAGCTTAACTTGAGTTTGAGTCTACGCGCAAGATCCAAACTCACCATGCTTACTGACGC
TCCAGAATCCAAAAGGATGTCTGTCCGACAATTGTTCACCGCTCCGTGAACCATCGCAATCCGTTTCGTGTCATCCGAACAGTGATCTTCCCACCAGCCA
TATCGTTCGCCTGGTCCCAGTCGGAATTCAACAGGTACATCCGGATCTTGTATTTCCGGCCGTACACCTTCCGACGGAACTCGTTCAGGACGAAGTTCAT
CTGAAAGAGGGTCACCATTTTCCGGAGTCACGGTCATGCATTGATGTTTATCCTGTTTTTGGCGTCTCAACTCCGGACCAACATACACTAGAAGACACAT
ATCGGGGGGTTTCTTCAGCCCGTCGCGTTCTGGATCCCCATATAGCGGGCTTACTAGTTTAACGGCTGTTCCCCTGGATCCACTTTCCCTTCCAGAAGTT
GCTTCCGGATAGGAGACGGCAGATCTTTCAGTGCTCCTTGACGTGCAAGATTCTTGATCGCTTGAAAAGCCTTCCATTCTTCACACTTGCCTTCGTGAAA
CTGGTTACAAATCGCACACGGACGAGTCCTGCAGAGGTGTGTCGGATGTCCCATCCGATGGCATCGATCACATTCGATGTCCGACCAACAATTCTCCGTC
AGATGTCCAAACTCCTTGCACTTGTCACAGAACTTGGACGCGTTCGGACTTCCAAAACGTTGCTGCCGGCGATCCGAACGGAAATCAGAAGTCGGTGGCC
GCCATCCAGGATTCTCCATCGCACGAAATACTGCTTCGGAAAGGTCATCCATGCTCGAAGTAGTCAGCACACTAGGAACATGTTCTCGACTTGGCACTTC
TTCCACATCTTCCAAAAAATGGACTTGTCTGCCGTGTTCGCCATCCCGGTTATCGTCATCGTGAAGGACATAGGCCCTTCCAGAACGTTTCGGTCGGAAT
CGATCACGAGGGACATTGTCCGCTCGGAAGTCTCTCTTCGGAGGTGGAGTATCGTAGTCGTCGTCTTGATTCATTTCTTCATGCTGTTTCAGGACATACT
CCAGGTCCTTCAGACGACGCAGACGTTGTCCTTGCAAAGTCGTTCGGAGGCGGGAGTCCAGAAGCTTCTTCGTGAATACTTTCAGATGGCGCTCACGTTG
CTTACTCGATGCGTTGAACTCGATCCCCGCTTTGTCGGCCACCTTGTTCAGGCGGTAGTAAAATTCCAGCGGAGTTTCTGCCTTCTTTTGGATCATCGTG
TAATAACGTTCTGAATCCGAGGTCTTGGCCTTGCAATACATATCTCGGAACTCCTTCAGGAACTTCTTCCATTTCCGGCGCACGTTGGGATTCAAGTTCG
AACGCCAGTTCCGAACGGCAGCAGGTAACTTCAGCTTCATCTCATAGATCTTGACCTTATCTGACCAACCGCCTTGAACAGCAAAACTCTGGAATCGTTC
CAACCACCGGATACGGGTAGCTAGTGACGCTTTCTCATTGAAGTCTTCCAACGTGCTGGCATTCACGTACGGTCTGAACGTGAACAGAGATCCGCCTGGA
CCTGGTGTCGTATGGACATTCGGAACGACATCTTCGAAAGAGCTGCTATTTGAACTGTCCGAGTCCGAGTCACTCTTACTGGAGTCAGAACTTGGGTCAG
AATCCGAAGGATCACTTGACTTTCCAGATGACTTCTTCGTCCTCTTTCCTTTTCCAGATGTCGAACTTTTCTTGGACGAACCAGATTTTTCGGACATGTG
CCGTTTGACGGACTTTCCAGGTGCAGTTGACTTGGTTCCAGAGGACAACTCGGCCTTTCCAGTTGCAGACGTTCTACTTCCAGACATGGGTTCCGCTTTC
ACGTTCACAACAGGCTCAGAAATCTTCACGGCTTTTCCCATCGGGTTCTTCGAAACTCTGTCACCAGCAAATGCCTGCAACGTAGCTTGCAACTGTGCCG
CGAAGATCTCGTCAGAGCTTCTCACATCCGGCTTTTGATGTATCGTGTCAGCGGCAGTTCCGGAAGCACTATTGCGATCTGAATGGGCGGCTGTACGACC
GGAATCCGGGCGTACCATCGGAGCCGAACCAACTTCTTGAGCCGAAACACTTCCAGAAGGCTGCTGGGCAGATGCCGTTCGGAGTTCCCGCACTTGGCCT
GCTAGAAACTTCTGCAGGTTCTTCGCAGTTTCTCGCTCTTGCTCCCGGTCAACCCGTAGAGCTTGGAGTTCCTGCTGGAGCGTGGCAACCATGGCTGCAG
TCCTCTGTGCTTCATCCGTCTGATATGCTTCCGCTTGAGTCTGATATTGCGTAAACCGTGCTTCCGCACGTTCGCGTTCCAGACGTACTGCTTCCAAATG
TGCTGCATCAGGATCATCTTCAGCGTCGTGACTTCGACGAACTTCCACCGGAGGTTGAACCGGTTCCTGTTTCGGAATGACGTCCCTGAACTTCTGTTCG
ACAATGTGATCCAATTTGGCTTCCAGACCGGCAGACATCTTCTCGTAGAGAGATCCCTGCTGAAGTTCCATTCGCGCCATCGCTTCCTGAACTTGGTTCA
TTGTGTTAAGCGCGACTTGTGTAGATCCGGAGGTTACCGACTGACGTGATCTTCCGGAATGACTCGAACGAGAGGATCTTTCGGAGGGTGACCGACGTTT
GGGTCGTGTCGAATGTCTGCTGTTGGAACGTCCACGCCGACGACGGGCATCTGCATCAGAGTCTTCTGACGACGACTCGTCTCGGTATCGGGAGGTCCTT
CGGGAGGAAACTTTGGACTTCTGTCTTCGAGAACCCTTTGCTTTGTCTTCTGACATGACGATGTCTTCCTGAATCACTGGTACTGGGTTCCGTGGAATCA
CTTCGTGAGTGACGTACATACCTACACCAGTCTCTGCCGCAACGGCTCCTCCCAGACTCTGAGCTGTCATTGCCCGTGGTTCAAACACTGAGAACGGCAT
ATGCACTCCTGCACCTTGGCCAACACTCCATCCGGAAGATCCAGACGAACTATCTCTGGAAGTCCGTGAACTGGATGTAGCACTAGCCATCGACTCGCTT
GACCCTCCGGAAGTTTCAAACATACTCGGCGTAGAATCTGAGCCAATTCGTTCGGATACATTCTGGGCAGAGGACAAACTGCTTCTGGAGGACAACACTT
CCAGGTTCTGGACAACCGAAGATGGCACCGACTGGAGCGATGACGGCGACGGGATCGATGAAGGAGGCGGTCGGGCAGCCACACGTTGAACACGTTTAGA
CGCAGCTTCTTCGTCCGCAACCCCTCGTGGACTTCGCACCTTCCGGAAACCGGCAGCTTTCAAATGCCACACATACTCCGATCCCAACAGATTGATCTCG
TGATCCGTCGCGACTACTATTCCAGGCGGAAAATGATCGGCAACTTCAAGACGCAGTCGATCAGCATCTCCAGGGGCAGCTTGACTCAGCACTTTTAGAA
ACTCTTGAGCCTGATTCACCACCTGTCTCCACTCAATCAACTCCACCACAAGTAGTTGCAGCATTTCGCCCACCATTCGTCGGACAAGATCCGGATGCAC
TTTGTAGACTCGCGTCCGGAACCATCCAGGCACCAAATTGACAAACTCGAAACCAGCCTCGAAAAGGATGGTCTGCAAGACAGCAACACAATCCCGGGGT
GTGAACATTCCGGGAGGAATCAGAGCGGCGGTCAGATCTCGGGCCATTCCAAACGTGCGACGTCGTAACTGCATCTCCGCAATCCAGGCGTCCGCTTGAG
TCGGCATCGACATCCGTCGTCTCAGGTAATCCGAAGTAGTCAGACTAGCAACCATAAACGATTCGGAATCCAAATGCACTTGTGGCCAATCATACTTGAC
ATCCGGAGGGACATTCTTTTCAGAAACATCACGTTCCCAACGTCGAACTTGATCTGCCACATACGCTTTTGCCTGGGCCTCCGTTATTTGAACGTCGGCC
GTCCCAGTCTCCACTTCTTGAACTCCAGGATGGTAATCCTTCTGCATAGCGGTTGGAGGGGGCTGCATCGACACGACATCTGGAAGCTCCATCTGCAATG
GGACATCCGGTCGCACAGGCAAAGACATCTCCACATCTTCTAGCACAGCATCTTCTTGAACGGTCGATAATGGCCGCTCATCTTTGATTGTTTGCGCTCG
TTCGGATGTCTTGATGTCATCCAGAATTTCAACTTCTTCTTCCGGCTGGAGAGAGTCCGAAACTCGATCTTCTGCCGGGGGCTCAACCTTCACGACGTCT
CCCTCAGACGCCTCATCAGACTCTTGCGAGCTGGAATCATTTTCGTCATCTGAACCAGATTCCGATCCAGACCACTCGGAGCCTTCTTCCCCATCCGAAA
GCACCTCCACATCACCGTCCTGATTCGCTTGGTGCGCCTCCTGAACGGCGGATCCAGAAGTGTCTTCTTCTTGGGCCGTCGACTCCTTCGCTTCTTGGGC
AGCCTTGCGCTTCGCAGCGTTCGCCTTCCGAGCATTCCTGACGACCTCATCCAAAGTCGCCTGCTCCTCCGGAGGCAGCCCTTGTACTCGACGTGATGAC
CGGGACGCATCGCCGCGTTCGGATCCCTCACGTCCACCTTCGCATGTGCTTTCAATTCCAGCCATAATAACCACGGTTAGAAGATTAGTTAGCACCCAGT
CCCCTAGAACTCAATCAATAATATAAGAACAACTCGGTGAAATCACTAGACGTCCAAATCCGGGCACGCGCACCAGCTGAGGCGAGGCGGGTGAACGCCT
TTATCGTCCAGGGGGTATAGCGCACGCGCGCCAGAAGACTCGGCCGATCAGGAAGATTAAACTTCGCCTTTCGGAAAGCCCAATGGGGTCAGACTACCTC
CAAAAGTACGGGACCTCCGGAAGTAGCTTGGCGTGTGACCTTGTGTAATCCCTATAGGTGTCGTTTGTCTTCGGAAGACCGGACTCCACCTGATGAGTTG
TTCCTACACAATCAAAATGAATACAAGAATACAGAGTGCGTACGTTCACTTCTCGACGCAATTAGTACAACTGGGGTTAGACCACTAGCAAAGCCTTCCC
AGATGACCAAATAATACAGAGAGTTATACACAATATACAGCTGCTACTTATTCTTTTGGACCCTTGAGCAGTGGGTCCGTACACCAGTCTACTTGTGTTT
CACCTGGAAGACTGGTCACTTCCAGATGCACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTATAACTCCTTCCAGAAGATAACTTTCAGATATATC
CAAAAGGAAAACCACTTCCGGATCACTCAATATACAGTCCTATCACACAGCAGTCTATTCGATCAAATTCCGGGGGGTGACTACTAACAACCTCCTGAAA
CGGCAATTACTATGAAATGGGGGGTCTAGAGGACACACTCCCAACTGAAATATGAAATAGGACAGATCACGTACGAATGCGCGTCACTCGGTCACCGCCT
AATTTGGTCTTGAGCCTTTCGGAGAGTCCCACGGCGGTCTTCGCGATCACGACGCGTCCAAACGCAGGCTGGGTGAACCCGGGTCCCCGGAAATACACGG
CGGCTTGTCCGGCGTTATCCCAGCGTGCTTCCAGGCCAACTGATAAGGGCCCTGGAAAACACTTGCGCCCTTGGTGGCAAAACGAACTCTCTGTTATTTT
TAGTCTCTGCTAGAAGTCTTCTGTCAAGGTCTCTGCTGGAAGTCTTCCACATGCACATTTGTCTTGGTTTCACTATAGGGTTCTTTGGCGTAATCAGCAT
CCGGGAGGCTGACACATCCTGGTCGCAAGCCGGCTCTTCGTGCATAACATATCCGGCTGGTCGTCTTGGTCGGTCGCTAATATCTTGGGCTTTGTATACT
GGAAAATCGGAAAGGTCTTGGTGGGTACAAATCAGGGGCGTCTGGTCAGCCTCCGCACCCACAACGTCTGGGTCATCTGCGAGTCACATCAGGAAGGAAC
TTTCGGAAGGCACACGTGACTTCCGGAAGTAACTCGACATTGGGAGGACTTCTGGAAGTCACTTGGTCTCAGTATGCTGTGGGAACTTGTACCAGTTCTC
CGTTCGTCCTCGTTCTTCCCTGTCGCGCGCACTTCTGGACCAATCATCACCGCGAGTGCTTCCATGGGAAATGGGAAACGACGCTCGGACATTTTACGTC
CAGTCGCCACGTGTCAAATTCATGTAGGAATTTCCGGATGTGCGGAGGATACTTGCGAGGCTTACACTTTGTTGGACGAGCCCCATCCTTCAGTCGCGCT
TCGAGCGGTGGCACATTTGCCGGAGGATCGTCACGCAATTCCAAACGCCACACGTCGTACGCGTGTGCGATCGTGCGCAGCTTCTCCACATGCTCCAACG
GAAACCCATTCGCCACAGTACGATCAATCAGCCTCTCTACAGCAGCAAAAATGTCATCATCCCCACTTGGGCCCGGTCCATCCAACTTGACTGGCATTTC
ATCCGCCTCCAAGTCAATCGGATCACCACTGGTTTCATCATCACTGCGTGTAGCGAGCTGCTCCAATTGACGATCTACGTCGATCCCCAATGAAGTAAGG
AGGTCATTCCCAACGATGAACTCTCCATCATCGATGTCAACTACAAGGACGTCCACGCTGTTCATGGGTTCCACCGGACCCACTGCCGTGTGTATCATCA
CATGTAGTTTGGCCTTCAACTTGGCCGTCACCGTCGTTGAACCTGTTAGAGGGTGCTGTGTGTGCATGTGCGTGTGTGCACCAGGTGTGGGTGCAAGGCG
TGTGTGCGTGCGCGTGCCTCTACGCGTGTGCGGGGGGATTTGTAGCGGCGTCAAGTGCTCATGATGAGACGCGCAGGTTGCGTGCGCGTGAGAACAAGCG
TGTGGGAGCGTGTCCAAGTGCTGAAGCGGCGTGGACATGCGTGTGGGTGCATAGTAAGAGTTACATATGTAGAAGTAGGGTGTGCGTGACTTTGGTCATG
CAGTATGGTGTAGTGGGTTAAGTGCCGGGTCTTTGATCCGTAGGGTGTGGGTTCGAGTCCCCCACATGGACGTTTTTCTTTTTGCCGACAAGAGAGCGTA
GGAGGCAGGCTAGCAGCTAAAACTCACTCAATCAATCTCACTTTTGGTTTTGCAATCTCGGCCCGAAGCCGTCTTCTAAGCTTTCAACTCTCCGCAGCTC
GTAGCCCAACTTCCTTTTGGTTATGAGCCCAAGTACCGACACCAAGTTCAAGGTCGAGCCTTTCGACGGCTCAAACTACTCGCTGTGGAGCTACAAGATG
AAGATGTACCTGATGTCCAAGGGATTGTGGGAAGCTGTCTCCGGGGAAGCCGGATCGACGGCGAAGGAGCAACAAGCGCACGCGGCGATTGTGCTCAACC
TGAATGACTCGCAGTTGATGCACGTGGTGACGTCCACGACTGCGAAGGAGGCGTGGGACACGTTGAAGAAGTTCCACAAGACTCAAGACATGGCGAACCG
GCTGTGGCTCAAGGAAAAGTTCTCGGCGTTCAAGTTCACGGCGTCCTCCGTCGGCAAGCACGTGACGGAGTTGGAGAAGCTCGTGATGGAGATGAAGAAC
GCGGGGTGTGAGCCAACTGAGGAAGACGTCTGCGCGACGATGCTGCGGAGTCTGCCATCGAGCTACGAGGCTCTGGTTCAAGCGTTTCGCATGTCAGTGA
GTGAGTTCAAGCTTGCAGACCTGGTGAGCAAGCTGATTGCGGAAGAAGTGCGTCAGAAGGACTCGAACCGCATCGAAGAGGCGACTGCGCTTCTTGCCGG
CAAGGGCAATGGGAAGCAGCAGCAGAAGAAGAAGAACGCACGCGGGATGCGCAAGAAGGGGCCCTTCGGGAAGTGTTTCAACTGTGGCAAGCCTGGCCAC
TATGCGAGGGATTGCCGTTCCGAGGCAAGTCCCGATGAAGATGTCCAAGACCAGTCGAACGTTGCGTTCCATGCGACGGAAGCTTTTGCTAGCGAGTGCT
GGGTGATGGACAGCGGTGCTTCGGCACACATGTGCAAGACACGCGACGCGTTTCAAGAGTACTCGGGTGTAAAGACTGCGCGCACCATATCGAGCGCAAA
GAGCAGCGCGAGCTTGAAGATTCTCGGGGTTGGAACAGTTGTTCTGCGTGTCTGGACTGGTAGTGCGTGGATAAACGCGCGACTGGAAAACACACTGCAC
GTTCAAGATTTGAACAAGAACCTGTTCTCTCTCACGGCTGCAACGGCACGCGGCATGACCGTGACTATGGACAGCGAGCAGTGCGTTGTGAAACGCGGCG
GCCAAGTGGTGGCGACGGGCAGGAAGCAAGGCAAGCTGATGTTCCTCAACATTGAGGGCGGCGACGAGTGCCATGCGGCTGAAGACAATATGGATTTGTG
GCACCGGCGACTCGGCCACGCGTCTTTCGGCACGCTGAACTCCATGATCAAGGACGGGAAACTCAAGGGTGCGCTGGCAGAGCCTGGAACCGTGTGTGGC
GTGTGTGCGACTGCGAAGCAGGCACGCAAGCCTTTCAAGTCGACCAAGGAGGGACTCGAAGCCAGGGAGAGCGCACGCAAGGACACCACTGTGTGCTCTG
ATGTGTTGGGGCCCGTCACTCCTGCATCCAAGTCGGGCTACAAGTACATTGTGAGCTTCATCATGATGAAGAGTCGCTTTGTGACAATCTACCCACTGCA
CAAGAAGAGCGAAGTGTGTGAGGCGTTCAAGAAGTTTCTCAAGGAGGCAGAAACAAGTGCGGGCATCAAGGTCAAGGTGCTACGCAGTGACAACGGCGGT
GAATACTGCAACGCGGGGATGGTGGCTCTGTGCGACGAGAAGACCATCAAGCAAGAGTTCACGGTGCCTTACAACCCGCAACAGAACGGCATGGCAGAGC
GGATGAACCGTACGCTGGTCGAAATGACACGCTGCATGCTGGAGGAGAGCGGGATGGACAAGTCGTACTGGTGCGAAGCCATCATGACAGCTGCAGACAT
TCGGAACGTGTTGCCTAACACGTCAAGCCCACACGCAAGCCCATTCCAGCTGGTTTTCAAGAGGGCGCCACGTCTGGAGCACATGCGCGTTTTTGGGACC
GAGTGCTACGCCCATGTGACCAAGCAGAAACGCAAAAAGCTGGACAACTCGGGGATCAAGTGCGTGTTTCTCGGCTACGCCAAGCAACACAAAGCATATC
GACTCCTGGACCCCAGCGACGGATCGATCGTGATTTCAAGGAGTGTGGCGTTTGCTGAAGCGCCACCGGTCACAATGGCGAAGACGCGCAACCAGGAGGT
GATCGACATCATCGACAACGATGAAGAAGAGGAGCGCACCGAAGAACCCAGTGTTGACGACGGTTTCAGCACGCCCCCGACACGCCCACTCCACGAACCC
GAGGAGCACAGCGGACCGACCGGATCTGTGCCAACGCGTGGCTCTAGCACGCCAGGGAGAGACGGCGAAGAGGAGTGGATGGTGCGTCCGGCACGCAAAA
GGCGTGGAGTCGTGCGCTACCAAGACGAATTTCCCGGGACTCGAAGGGGTGAGTTCAACCTGGACGACTACGAGGCTGAGTTCGATTCCCTCTACTGCTT
CCTCACCGAAGACGACGACGGTGAGCGCGCGGTGTCGTACGATGAAGTCATGCGGAGCAAGTACAAGGACGAATGGCTGCGCGCCATGGAAAGCGAAATG
AAGTCGCTTGAGGATCACCGCACCTGGAAGTTGGTGGACATGCCGTCAGACAAGAAGGCGATCGGGTGCAAGTGGGTGTTCCGTATCAAGCGTGACCCGA
GCGGGAAGATCATCAAGTTCAAGGCTCGTCTTGTGGCGAAGGGCTTCACGCAACGTCCAGGGGTCGACTACACGGAGACTTTCGCTCCTGTAGCACGCAA
AGAGTCCATCAACACGGCGGTGGCGATTGCAGCAGAGGAAGACATGGAGGCTGAAAATGTGGATGTGGACACCGCGTTTCTCTACGGCGACGTTGAAGAG
GAGCTCTATATGGACCAGCCGGACGGATTTGAAGACCAAGTCAACCCAACCAAGAAGTGCCTGTTGATGCAAGCGCTTTACGGCACGAAGCAAGCGGCAC
GCCAATGGAACAGCAAGCTGAACAAGCACCTGGAGGGCCAAGGTTTCCATCGGTCAGCGGCGGATCCGTGTGTGTATGTTCGGCGTTCGGACTCGAAGTT
CAGCATCATTATCGTCTACGTGGACGACCTCATGATCTTCAGCAGGACGAAAGCGGAGATCGGTGAGATCAAGAAGGCGCTGAAGCGCGAGTTCAGCATC
AAGGAGCTCGGTGAGCTGAAGTACTGTCTCGGCATCGAGATCCACCGCAACCGCGACGACAAGACCATCATCATGAATCAGCGAGCGTATATTCAACGAC
TCGCGGAGAAGTTCGGCGTGGAAAAGTGCAAGGCAGTGCACACATCAGCGGACAGCAACTCGAAGCTGGTGAAGCCGTCAGAAGACGAAGATTTCGTGCC
CAGGTACCCGTATCGCGAGTTGGTGGGGGCTTTGATGTACCTCGCAACTTGTACGCGCCCGGACATTGCTCAAGCTGTGGGTGAAGTGGCCAAGTTTTGC
GAGCGGTACAACAAGTCTCACTGGGTGGCTGCGAAGCGGATTTTGAAGTACTTGAAGACCACTCAGGACCTGGGACTCGTGTTCAACGGCGGGACTAAGG
GAGAGCTGATCGGCTACGCGGATGCGAACTGGGCAGGTGATTTGGACACCCGGCGCTCGACTACTGGCTACGTGTTCTTCCTGAACGGGAGTGCAATTTC
GTGGAAGTCGAAGCGGCAACCGACAGTGGCAACCTCGAGCACGGAGGCAGAGTACATGGCACTGTACAACGCCACTCAAGAGGCAGTGTGGCTGCGTCAG
CTACTACTGGACGTGGGGTGTGAGTGTGTGGGTGCGACTACCATTTTTCAGGACAACCAAGGTTGCATTGCGCTGGCCAAGAACCCAGCGTACCACTCAC
GCACCAAGCACATCGACTTGAAGTATCACTTCTTGCGCGAGAAGGTGGAAGACAAGGTCATCGTGCTCGAGTACAAGCCGACAGACGAGATGATCGCAGA
CGGGTTTACCAAAGCACTGGCGCGACCCAAGCACCGCCAGTTTCTCGTCGGACTCGGCATGGACGCCTAAGACGCCAAGCACAGCGCATCAAGGGAGAGT
GTTAGAGGGTGCTGTGTGTGCATGTGCGTGTGTGCACCAGGTGTGGGTGCAAGGCGTGTGTGCGTGCGCGTGCCTCTACGCGTGTGCGGGGGGGATTTGT
GGCGGCGTCAAGTGCTCATGATGAGACGCGCAGGTTGCGTGCGCGTGAGAACAAGCGTGTGGGAGCGTGTCCAAGTGCTCAAGCGGCGTGGACATGCGTG
TGGGTGCATAGTAAGAGTTACATATGTAGGAGTAGGGTGTGCGTGACTTTGGTCATGCAGTATGGTGTAGTGGGTTAAGTGCCGGGTCTTTGATCCGTAG
GGTGTGGGTTCGAGTCCCCCACATGGACGTTTTTCTTTTTGCCGACAGAGAGCGTAGGAGGCAGGCTAGCAGCTAAAACTCACTCAATCAATCTCACTTT
TGGTTTTGCAATCTCGGCCCGAAGCCGTCTTCTAAGCTTTCAACTCTCCGCAGCTCGTAGCCCAACTTCCTTTTGAACCAAACGTCTGGTTCAGGATTGG
AACGTCAAGCTCCTCTGCGACCACACTGGGGTCCAAAGCTTGCAACTGCTCCCAATGCGAGTGCCCAATCACGGCGTAGTCCGATCCACTATCGGGGCAG
AACGGAAGCTCCAGCTTGCCATTCAATGTCACCACCCGATCAGTAGATGGCAGCAACTCACCAAGTCGCTTCAACCTGGTCTTCTTGCTCTTGCGAGCTT
CACGCATCTTCTTCAGGAGTTCTTCTTTCTCCTTCGATGTCGCTTGCGTGCACTCACGCAGCCAATGCAATTCTTGGCACTTAGGACATGGTCCTGGCGG
AGGTTTCGACGAAAATGGAGTCTTCGTCTTCGAGTCGGACTTACCCCAACTTGTAATCGCAGCCGGACTTGGTGTAGTCGGCGCAGCTGGTGTCTTGGAC
TCCCAACGCCTCTTCGGTGTCGCCGAGTGGTAAGGCTTAGGCTTCTCCTTGCCTGACCCATTCGCATTACGCTTCTCCTGTCGCAATCGCTGATGCTGGC
GCTCCAACTCGTTCGCCTTCTCGAGGGTGAGACGGAACAGAGCTCTCGGGTCCCTTCCAGCTTCGACATGCGTGAAACGAACGCATTGCTTCACTTCTTG
CTTCAACGACTTGGGCAACAGGTTCGCGATCAGTCTCTTGCACTTCTCCTTCGTACCGTTGACTCCGCTGAAGCACTCAGTCAGACCGTTGTCCTCCACG
ATGTCCGTGGAGTTCTTGTAATAGTCGATCAGCCTCGCGTTCACGTCGCTCTCGCGCATATTCATGCACAACTCCGTTTTGAACAGCATCTTGATGTCAG
GAAGTGTATCATTCTTGATACTACTCACGATGTGCTCGATTTCGGCAGTCCGTAGCGTTTGCTGACCCCACGTTGAGTTGTAGTTCGCAAAACACGTCAA
GTAGTCGTGGCTCGAACGAGTCTCGAATCGACTGCACCACCGCGTCGCAGTCCTCGCCTGTGACTCGGCAGCGTGCTTGCATCTTCGACTCGTAGTCGCG
TCGATCCCGCTTCCACGTCACTAATGCCTCATGGGAGACTGACTCGATCTTGGGTGGCAGGATCGGAGTGAAGAGTGGGACGGTCCCAGTCGGGCCGTCC
ATTCCAGCAGCGCGCATTATCTTGCACGGCAACTGGATTTCTTGAAGTTCCACCGACGATTCCGGTCGTCGGGTTTGGAGATATGGCTTCGGTGCCACTG
AGAGGCCAGTCAGTTTGTTGACGGCGGCCGAACAGTGGTAATCCTACTAAAGAATTCTTTGTGGTGTATTCCCGGGTCCGAATATCAAAAACGCCAACAC
AGCAATGCGGGGGCCAACCCGCACGGAAGTAGTAGCCGAATATATTGATGTGCTGGTCACTTGGAAGATTGGAAAGTGAGGGACGGAGGAAGACCATGAG
TCTGATGCTAACCAGCTCGTTCTCCTCCAGCTGAGCCCCCAGAGAGACAGACTGTCGTAGGCAGTAGCCACCTGCCAAACAGCCTGAGAATGTACACATG
CATCCACATCACAGGAAACATGCAGTTGGCAATACTAAATCCTTATGCAGCTCAGTACGACACTCTTGGCCGTTACTGGCATAACAGTTCACCCATTGTC
CACGCCTGGCGGCCGTCGGACACATCCGGGTCATCTGTGATAGACATCACTCAGCGACTGAGCCACCGGCTCAGCGCCAGATCTGGATATCTCTTAGCAA
CGAAGTTCCGCTGCGGTGATTCCAAGCTGAAAGCCCAGAATCCATTACAGAAGTGACGAGGAGGTGAATTGGGGCTTCACCAACGAGTCTCTCCATACCG
TCCTGGGCGACTACCAGTCTCTGTTTGCGCATGTGAACTCGTTGGATCCGCGTATCCTAGTGGCGTTGAGGCAGACTTACAGCAAACAACTGGCAGGGGT
CTACAATGCGCACGCTCAGTCTCTCTTCAGGTGCTTGAAGGACAAACTCCCTCGGACGTCGAAGCATCATTTCCACAAACCAACTTCACTTCAATCGCGT
GGCATTCACCTATCGTCTTCTCACTTTAGCGTCGGCGACACTATGTGTGCATCACCTCTGATGCAACAAGCACTCGACCACCTCACGCCGCTGGTGCTGA
GCGAGCAACGACTGGTAGCTCGACTGTTTTTCCCGTCAACGACGGATCGCGCGAATTCTTCTGGTGGAAAACATGAGCTGGAGGACCTGACACTCACGAT
GGAGAGTATTTTTGAAAAACTCTTGAAGCGGATGAACGAATTTGGCGAAGCGGCTGGGCTTCGTAATATCTTGGATGCTCTTTCACTCGTGGTGCTGGTA
AACGGGAATCTCGAAGAGTATCGGCAGCAGAGTGCGTTCCTGTACAACGTCATGGTGAGCTTTCAGCTTCAAATGAAGCGTATGCTGATCAAGTTCACGG
AAGAGCAGGTACCACATCAAATGACTCGCTATAGCGTAAGATTGCTATGCTGTGAGCTGAATCGCATGTCTTGTGGTCACATTTGTAGGAAACCTGGATC
AGCGCGCAAAGTGCTGATACAAAAATGGCAGGCGTCCTTGCTCCAGCGAAGAAAATTGTGGTAAGATGCTCAAGTAATCGAATATTACGGCTGTTCATCA
TCTTTGCTGGTACTTGTGTAATGCCTGCTTGTAGAATATGATCGCCCGAATGGAAGAAAGCGTGTGCGGCAAGACCGACGACAGCACATTGATGTCAATC
TACAACATGATGTTGCCTGCTACCATGCAATGGGTGGACAAGGTCGCAGAATCGCGGCCAAAGTACGCCTCGCTGACTCGCCTTGGTACGGTTGAAAGGT
AGATCTGCTTCTTTACTGCACAGTGGCTAACTTACTCTGCTGCCAAGAAAACTACCTCTTTCTCAGCGATAATCTGAAGGCGATCAACGGATCAAAGGAG
CTGCCCCTTGCGCAATACGCGACTGAAGCACACGACCGATACACAGAAAACCTCCAACGCTACGTGGCATCTGTCTGGGAGTACGCTTTCAAGCAACTCG
TGGTAAGGCGGGATGAATATGTATAGGTGCCTCGGGTCTCTGACGTGTTACTGCTGAACTTCTAGCCCTTGATGGCATCCATCGAATCGCTGATGACCAC
GGTGCCTGCATCAGAGATCCAGTATCATTCACCGCGCCAAGAAGTTCGTCGTGTTCTCGACTCCACTGCGAGCACGGTAAGAACGGGAAGTCGAGAAAGA
AAGGTTTGTGCACACCTGACAGTGTTTTGCTTTTGCAGTTCGAGAAATCTGTTCGCATCATGCATGATCGCATGAAAAAGCACTTCCGTGAGAACCCAAA
GATGCTGCCAAGCGTGTGGAAGCAGCTCATAGCGTACGGGAGCAGTCGTGTGGCGGTGTACGCGCTTGTTGCAGGAGACTGTTATCAGCTGCGTTTTGAG
CCGTCACCCGAACGCGGACTGGAAGTGCTGGAAAAGTTTGCCTTTACCTCAAGTTAACCTCTTCGAAGCTATCACGACTACCAGCACCGTGTTGACAACA
ATCTCCTTTCGATAGGAACAACAAACTCGCATAGACTACGGGGCATTTACTGCTTACCAGTAGTCCACGCGGTCTTCAAGAAACGTTCAGGCCCTACCTA
GTGATCATGAATCCAATACGACTTTGCATTTTGTCCTCTATTGCACTTCCTGAACAGCCTCCGTCTTACTCAACGAAGTAGCAGAGGAATCTAACAGTTC
TCGCACTTTTTCCCACTGCAACGAGCCGACATCCAGCAATTGCCACCGAAACTCCAGCGGCTTGGACGCCGGCCGGTGGCCAAGGTAACCCAGCCGACCG
CAATAGACATAAGGCCCCTGCAAGTCACCACACAAAAAACACCACACAACCGTTCAACATTCCACACCACCAACTATTAAAAGTCTCCTCTCCTCACCTG
AGTGTGTCGAAGAAAAAGTAGCAGCGGTTCCTCTGTCTCGCCCTCCTTGTTGTAGTACGATTCGTCAAACCTCAGCCCCTCCTCCCCCCTCTTCACACCC
CGCAGCCTCACCACCAACGGAGACTCTTCATGCCAGCGATTCTGTCCGAACCACTGGAAATGCACCACGTTGCGTCCGTCCACCTCTTCTTGATGGAAAA
TGTTATCATAGAACGAGTCGTTCTCAATATTCACGAACAGCACCACCGCGTTCTTCCACGGCTGCACACCGCTCATCTTGGAGAATTTGGGCACAAAACC
CGGTGGACACAGACCCTCCATGACTGTCTGTTTGCCCATTGGCAGCAGTTGGGTGCCCAGACACTTGGCGTGGAATTCTCCAACCGAAACTTCAAGTTGT
GAGCTCGAAATATGACTTTTCCTGCTGGAATTCGAGTTCTGTAGCTCCGAAGACAGCGTCACCGGTAGACCCAGCGGCTGCGGGGGCGAAGTCCTGGCTC
GTTTGAGACGCACGGGCGGCGGATCGAGCTCTAAAAACACCTCGGACCCATTTTCTGGACCATTTTCTCTGAGTTGGCGTTGACGTAGTGATCTTCGCAC
CGGTTCTGCGTCTTCCACCCCGCGCTTCTTACGGACAGAAGAGCGGACACGCGGCTGCAGCCTTGGCACGTGCAGAGTCTGAAGACGCCGCTGGTTGGCC
TCGATCCGGCGCTGTCGTTTGGCTTCGTACGCGCTCAACTCCATTGGCTCAATTCCAATTGTGGGAATTGTGCGCATTTATTATAAATGATGAATACAAT
ATATATGGGTATCTATTTATTTTTTTGAATTTGGGACATCGCTTCTCAATCTTCGATACATTTTCCAATTAAAATGAGGACAGCATTTTCCAATGATGAG
CTCAAAGTTTCCCAATTATCCAAATCCCAATGAGCGAGGCGAAACCCAAGCCGCTGCCCATGGCGCGGCGCGCGCTGCTGCGTCTCCGCGGCTACGTGGC
GTCTCGCTGTCTTTCGCTGTGGTGCGTCGAATGCGCGTTCCTCCCTCGTTCTCCTCATATGGCTATCGTCATAATGCGCTGCGTGCTTGTCATCTATAAT
GCTAACGTTATTTGTCGTCTTATTATCTTGCTTTTACCGTTTTTCAGCTGGGTAACGTACATTTTGGGTCTTTTTTGGCTGCTATTGCATCCTGCCGTCA
CTGTCACGACCGGTACTGCCTTGCTTTTATTATGTTTAAATGTATAATAACGCTAAAACACGGTCTGACGTCTTTTCAGGCGAATTGAAGTGCCGCGGCA
CGTACATGTCCGAGAACGCGCTGCTTATTGACCTCATGGAGGCTCGGGCCAGTCACCAGGAGGCCTATTCGGCGCGAGGGTTCCACCAGAAGCTGCTAGA
GCTGCCGGAGCTGCCCTTTGGAGGCTGTGGAGACAATTGCTCGGCGATTGTGAACTGGATCGACATACAGTTGCGTAGTTTGGACCGCGTTGAAGCATAC
ACTCAAGTGTTCAAGACAAATGAAGCCTCCGAGCCAAGGACGAATGTGTACGGAATTTTAAGAGCCTCGCCATTGGCAGATGGAAAGGTACAGACAGGAA
GTTTTTTTGTAGTGGAGAAAGGCGGTTGATTGTGATTGTCATGGGTTGTTACTGTGCCTTCGCAGGAAGCTATTGTGCTGGTTACGCATTTCCGCAATGT
GGGTGCTGGGAGTGGGGAGTACTCTGGGTTGGCGCTGGGACTAGCGTTGCTCAAGTACCTGTCGAGGGCCAAGTGGTTGGCGAAAGACGTCGTTCTCCTG
GCTGCTGACGGTGCGGTTAGTTTTCCGATTTGAGAATGATGTATAATTTCTAAGTTTTCACTGTGTTTTGGTGCAATGCAGATGGCAGGTTGGATGGAAG
TGACGGGTATGCTCCAGGCACCGAGGCTTGGCTGCAGGCGTATCATTTGGACCCTATTGAGAGTGGTTTGCAAGGTGTGCTGCCGATGCGCGCTGGTGTC
ATTCGCGCTGCTATCAACTTGGAAACGATGTATGACACGCGTCAGGTGGGGTCGGT