Description :
From Genome Similarity Track
Location :
Scaffold_150:22605- 25157
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.2160S ribosomal protein L26-1
Pytul_var.sporangiiferummaker-pug3_contig_150-fgenesh-gene-0.12Viral A-type inclusion protein repeat containing protein

Sequence
2552 bases(100 bases per row)
AGACAAACAAATACTCACATGCTTGTGTGTGTGTGTGTCGTGCGCAATTTGCAGTGAAGTTCAACTCGACTGTCTCGTCCTCCCGCCGCAAGAGCCGCAA
GGCTCACTTCGGTGCTCACTCGACCCAGCGTCGCGTGTTGATGAGCGCCCCATTGTCCAAGGACTTGCAGACCAAGTACAATGTAAGTTAGTGGTTTGCC
GCCGTGCAAATACACTTATACTTTCAGCGTGTAAGTCCATGTCAGTCGGAGCCCCTCGGGTTTTGACTGGCACTTCATGGCATCGTGTGATATGTAAGTG
CCGATCCCAGTCGCTTGGCTGGCCATCTATCTCTCCAGTCTTTCCTCACGTTTTGACGTAGAAGACTGTGAGAGAATGGCTTTCCATATTGGTGATCGTA
TCTCGCTCCTGCCGAGTCGTCTGTCAATGGCAGGACTGTTCGTGTGCTGACTAGGCTTGCTGTTATTCTTTGTAGGTCCGCTCGATCCCAATCCGCAAGG
ACGATGAGGTCACCGTTGTGCGTGGCACGTACAAGAACCGTGAAGGCCGCGTCACCGCCGTCTACCGTAAGAAGTTCGTGATCCACGTGGCGGGTGTCGT
CAAGGAGAAGGCCAACGGCCAATCCGTGCCAATCGGCATCGACGCGTCCAAGGTGGTTGTGACCAAGCTCAAGCTCGACAAGGACCGCAAGAAGATCTTG
GAGCGCAAGAACCGCGCCACCGGCGACGACGCCAAGGGCAAGTTCACCGAAGCCGATGTCGCTCAGGCCAACGTCGACTAAGCTTCTCACTTCCGCATCT
TTGAGATCATGACAAGAGATTGAGAAAGAGGGAACTCCAGGCGCGCACCTCGGTTGGTTAGTTTGGAAGCAAGTCTATCTATTGCGTGTGTGGAAATTAA
AACCGCCCAATGGAGACAATGAAGCCCATACAGCTACCATCCTTTTTGCGTCCTAATTAACATGGCTTTTGCTCTACTTCCATTCTCGTGCTCTGTGGTG
TTTGCCCTACTTGCTGCATGAAATGCATTCATTCTCTATATGAGGTTATGAAAGCTTTTGCATCTCTGCGTGGATCATGTTCTTGAGCGACACGGCCGGC
TGGTCCGAGACCAACTCGATGAGCAAGTGGATGAAATCGATCTCGCGGTCCGAGTACTCGCGCAGCGCGAGCTCCTGCATCTCTAAGCGGCGCAGCATCT
TGTTGACGAGCGGCACGAGCTGTGGGATGGACCGCTTCACGGTCGCAAACACTTTGTCTTCGCACTCTCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNACCACTGCGTGAGGACGAGGACGAGTCTGCTTTTGATTTCAAGCGACTCATACGATCCCCATGCTTCTTGACAAATTTGTCGA
GAATGTCGGCTTTGCGTTGCTCCTGTAATGAACCAATGAACAGAGCAGTAAGTCTCAACTACACACATCCTCCTACAGAAAGCAGGAAATCCCTACATTT
TCTATGGACACCAGGTACATCTTGGTCGCGAGCAGCTCTTCTGTCGCTGCCGCTTTCTCGACCAGCAGCTTTTCGTTTTCCTGGTGCAACAGCTCGGCTT
CCTCTTGCGCTTGGTTCACCTCGGCATTCAGACGCAACTTTCCGAGCTTTGCCGCCACGAGCGCTTCTTCTTTGTTGGTCAACTCCCTGCCACAACCCAT
ACACAATTGCAAACAAAGACAAACAAATGAGTGCATCGATCCCCATTACAATTTTTCTGGAAAGCGCGACCATGTTGCTTACCGAGAGAGTTGGTCGACT
CGCCGTGTCGNNNNNNNNNNNNNNNNNNNNNNNNAGTCACTGACCAATTTGCTATGCACGAGGAATTGCCTGCCATGCTCACCATAATATTTAGGGCAAG
TTATTCCAAACAACAGAGCGATGCCGACAGTATTCAATGAAAACGCACCGTTCTTTCTTTCGGTACTCCAAAAGCTGCTTCTCAAGTTGCTGCTTCTCGT
CCATTGTGGCCTGGTACCGTTTCTTCAAGTCGTGGACGGATCCAGAGCCGCTGCATCCATCGTTTTCCGTCATCTAACCATAAAGAAGGTCTGTGAGCAT
TGTCAAATGCATCCATTCTCTGGCGCACGCACTCCCAGCCACTTACTTACCTTGAGCTCTAGACCTACGTTTCGATCGCGTAATTGCTGGACTTCCTTGA
GGAGTGACTGCAGCTCCTGCTCGTATTGCTCAAACACTCTTGGCAGCGCCGACTGCTTCTCGAGCGAACGTACTTTGCTGCGTAGCGCGACATTCGCCAA
TTTCAGGTTTCCCACTTGTACTTCAAAACTCGCGCGCACTTCCTCGAGGTCGTGCATGGCTTCGGCTGCTCTAGCTTCGGCAGCTTCGCGCAAATGCTGT
TGCTCTTGCACGATCGTCAGCAACGTGTCGTAGTTTTTGCGAAGCAGCGCAGCGTCCGTCGCCTGGATCTTGGTGGCAGTGGCAGCATCCAGACCCTCGA
CGTTGGGAGGTGACAGCACTCGCGAAGGGATGTGAGCCTTTTCCAGTGCCTC