Description :
From Genome Similarity Track
Location :
Scaffold_80:22605- 25052
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.4Protoporphyrinogen oxidase

Sequence
2447 bases(100 bases per row)
ACTGAGACGCCTCGCTCAAAAGGAGTGAGCCGCTGCATTTTGTTCAGCAAAAGAAGCAAAACTTCCAGCAGCTCCACCGCTCAACCTAAGACAACTGAAG
GTAGCGATTTGCTCCTCTTCGGCGAGACGTCAGCACCACCATCTTCACCTTCGCTTTCAAGCATCGAAAAATCCATACAATCCACATTTTACTAGCAGCA
CGCCAAGGTCCACTGAGCGCAGCAACATACTTGTAGTACCAGTAAAAAAAGTAGTACTATATTATGCTTCTTTTGAAATAGTTTTGAGTTGAAAGTAACA
CATTATTATATGTTTAAAATAGCATATTTAATAAAATATTATTGACTTATTTATGTCAAGGTTTTCAAAAGCCAATTAGATCGTTCCATTGGTCTCCAGT
GAGCCAATCAAAGCGCTCTATTGTTGTGTGCTTATGCACATGCAAAACCCAAAACAGCCACGCGGCTACTTTGGGTTTTGCCCGTGCAAAGAAACACGAC
AAATAGAGCGCTTTGGTTGGCTCACTTAATAATTATTGAGCGATTTGATTGGCTCACTAGGTGGAATACAAACGGAATGATTGGCTCGCTGAATTACCTC
TAACCCAATCAGATATTGACCCAAAAATTACATCATAAATACACCAAAATATGCTATAACTTAAATACACCAAAATGAGCTGCAACGACAAGCTCACATC
TGAACACCTCCAGAGCTGATCACTAGCTTCATCAGCATCATCATCACCCATCAAGCATGGCGGCGCTCGCGAAGCAGCCCGCGAAGGAGCTCGTGGTGCT
CGGCGGTGGCATCTCCGGCCTGAGTCTTGCGTACTTCTTGCGCCGCGCCATCCAGCAGCAGACGCAGACACAACAGCAGACGACACACATCCGGGTCGTG
GAAGCCGCGGACCAGGTGGGCGGCTGGGTCCGCACGGCCAAGCGTGACGACTTCCTCTTTGAAGAAGGGCCGCGCGGCTTTCGTCCGTCGCGCAACGGCG
CCGAGATGCTGCGTCTCGTTGAGGAGCTGAACCTGCAGAGCGAGATGCGCGCGGTGGACGCGGCCGCCAAGTCCCGCTACATCCTGCGCAATGGCCTGGT
CGAGGTGAGTTGAACGACTCAATTACATAGTATCACATGAGACTATCGACTGAACCTTGCTCTTCTGCGTATGGCTATACCTTTTTAGAAATTACCGTCG
AGCATCCGTGAGATCCTGTCGTGGCCGCTCACAGCGGAGCTCATCAAGGCCGGCGTGCACGATCTCTTCACCAAGCCCAGCAGCGTAAGACGACATGCCC
AACGCGCCTGCTTTCTCATGTTATGGCTCGTGGTGCAGCTCGCGATAAGTGTCTACGTATGCTAATCGCACGCTTGTTGTTGCTCCACTGTATGTCCACC
GTGTTCACAGCTCGACGACGAGTCGATCTACGACTTTGCCGCGCGAAGATTCAGTCCGCTCGTGGCGGAGCGGCTGCTGGACCCCGTGGTCTCGGGCATC
TTCGGCGGCGACATCCGCCACCTCTCAGTGCGCTCGTGCTTCAAAATGCTCCACGATATGGAGCAGCAAAGCGGCTCGGTCGTGCGTGGGATGCTCTTTG
GGAAAAGTTCGGCGACCGACACGCTGCTCGACGGATCCGCCAAGTCCGAGTTCATCCGCAACTACGAGCAGTCGGTCAGCGTGAGCTTCCAGAACGGCAT
GTCGTCGCTCATGAAGGCGCTTGCAACCGACATTCAGGTAGGTCTTGAATGTCGATGTGTTGCTACTGCCGCCTCAATCTCGTTGCTGACTCACTTACAC
TCGAATTTGTACAGAACGATCCGCTCTCCGAGATCCAGCTCAACACGAGAGTCGCCACTATCCACGCACACACCTCAGGCTCGTCTAGCTCTTCGTTTAC
AATCACGACCGAGAGCAGCAGCATCACTCCAGGTCCCCAGCAACAACAGCACCAAGAAGAGATCCACGCGAGCCACGTGTTCTCCACTCTGCCGGCGTTC
CAGTTGGCGCCAGCAGTCGAGCAATCGCTCCCTTCGCTCTCCAAGGCGCTGCAGGAGATCCAGTTCGTGCCGATGGGCATGGTCCACATCGGCTTCAACG
AGAAAGTGCTCTCGAGCGACGGCTTTGGGTACCTCATCCCGTCCTGCGAGGGTGAGAAGGTGCTCGGCGTGGTCTACGACTCGAATGCGTTCCCGTCGCA
GAACGCAACTGGTTCCCACAATGCGCAGACCCGACTGAGCGTGATGTGCGGCGGCGCTCACTTTCCCGAGATCGCGACCATGGGTATGGACCAGGTCGAG
CAACTCGCGCGCGACGCCGTGAAGCGTCACCTGGGGATCGCGAAGGAACCGGACTTTGTGCGCGCCATGATGCTCCCGAACTGCATTCCTCAGTACCACG
TCGGCTTCTGGAAGACACTTGAGCGCATTGAAAGCCGGCTGGCGCCG