Description :
From Genome Similarity Track
Location :
contig_47:226030- 227628
Transcript NameFunction/comments
g9671.t1RAW27616.1 hypothetical protein PC110_g15977 [Phytophthora cactorum

Sequence
1598 bases(100 bases per row)
CTAGACAAAATACTTCCTCGAGTTGCTCACATTGAAAAACGCACTGACGGTGCACAGATGATGTTATCGCAGCAGAGACAGCAGATGTACGAACGAGCTC
TGGTACGATATCCGCAATGCCGAAGCAACGTTTTTGCTCCCAGCATGTATGATCACGAAGAAGTGTCCAACTTGGATGCAGGCTCAGCACCTCAGGCACC
CCGAGCGTCACTAGAGCTTGATTTCGTATATGGATGCCGAAGTGGAGCCACGACGTCGCTTTCCAGCAGCCATCCTGCAGCAGCACCTAACACTAGTACC
AACAACAGCGCTTTCTACCTGTCAACTGGTGAAATTATGTGGTTCGCAGCGACGTTAGTGATTCTTTACAGGAAAGAAGCCAATACCCAGAGGTATTTCC
GGGAGCACACGAACGAGGTGACGAGTATAGCAGTTCACCAGAACCAGCGCATTGTAGCATCCGGCCAAGCAGGACGATCGGCGTTTCTCTTGGTATGGAA
TGCGAACGATGAACCGCTGGGCAAACGGTTTGCGTGCCTCAAGGGCCACCAAGTGGCAGTGCGCTCCATCAGTTTTTCTCATGACGGTAAATTGATCGCT
TCGTTGGGTGGAGATATGTACAACACCATTTGCATCCACGACTGGAAGGCGCAAGAGTTATTGGTAAGTGCTCGGGGGCACACGTTTCGGGTTCATGCGG
TTGCATTTAATCCTTTTCAGGCATACGGTCGGCCAGAAACTCAGCGATCAAAGAAACCTGGCCAAGCTTTGCACGATGACGATGCATGCTACACCCTAGC
AAGCTGCGGCGTCCGGCATATTCGCTTTTGGACACTGACAAAGTGCGTGCCCCCTCCATCAAAGGAAAATGTCGACAGTGCATTTTCACGCTCTACATTT
GGTGGTCCTCCAAGATTGCGTCCTCCAACACCGACTGAGAAGGTCTGGAAGCTGGAAGGCAATGTTCCATCGTTCCATGGTCGATTTGAGGTTCAGGACT
TTACAAGTTTAACGTTTGTGAACGATTCACCACCTCTGTATATGTATGATGAACACTCCAAGGAGTTGACGGCCACAAACGCTACTGATCATTCGCTGGG
TCGGATCGTAGCTGGCACGGCTAACGGAGATCTGTGTCTGTTCTTGCAGCCAAGGGCAAGCCCCAATATTGATTTCGTTTCCGAGGGTGATCTTCACAAA
GAGCCTGCAAAATGGTGGGAAGTTCCAGACGAATACACTGATGCTGAGATCAACGAACTCGTATTAGAGAAAATCGCATACGAACCAACAGCGAGACTCA
TTGATATCGTGCCTCATGACCAAGAAACTGGTAATCGATTTAAACTACCTAAACAAGCTCAAGCGGAGATGCAGAGTTTATCCAAGAAAATGGCGTTGAG
GCCCAACTCAACGGCCTTGTTCTCACGGCTGGGTGAACTAAAGTATAGCGGTCCGTTAGCTCACCAAGGAGCAGCTTACCAGGTGGCGTACTCCAAGAAA
CGCAATACGATTATTTCATGCGGAAATGAAGGCAAATTGCTGCTGTGGAAGTGTGAAATGAGTAAGCCGCTACGAATCCCTGGAGTTAATACGTTAGG