Description :
From Genome Similarity Track
Location :
Scaffold_178:22603- 27166
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_178-fgenesh-gene-0.3Endomembrane protein 70
Pytir_DAOMBR486maker-pir_contig_178-snap-gene-0.32Conserved gene of unknown function

Sequence
4563 bases(100 bases per row)
CGATAGCTTATAAATGATGTGTCACTCACAGCACCACACCAAAAACCTGAGAAGAGCCCTCTCCAGAATGCCCAAAATAAACATTGCTGTAACCGTCGTT
GCTGTGGTCCACGGTTCAGGAAGGTTGAACCGTGGACTGACTGAAAATGAAGTGAGCCGCAACTGAAAGCGATCTGGAAAGCGGGACAAAGCATATGCAT
GGGTTGGACTCCTTCTCCTTCAGCTTTGCATCTTATCACACCACTTGGTCGCACTGCTGCTGCTCGAGTACTTTGTGTGCTGACCAATCAATCACACACG
CACACACACGATCTTTCTTCCATCTGCGCGTTTTGCTTCACATGACGCTTCTGCCGTGAGAGCATTTCAAGCCATAAAATAGCATTTATTCGCGTTTGAG
TACCCCAGTTCGACCAGCAAGTCAGTTGCGCATCCGAAACGCCAAAAAGGGAGGTTCAATAAATTTAGTTTCGCAGGTTAATTCCATTGGAGTACTTAGA
AAAGGTCCACTATTATAATTTTTTATTAAATTATACAGGTATTTGGCAGTCATGCTTCGAATAGTGAGCCTTTGGAAGTGGCAAGCACTCGGCTCCCTCT
CGCACGATTTCCTTCCTTTTTCCTGTCTCTCACGACTTCCCCCTCCTTAGCCTTTAGTATCAAAAAGAGCCGACGGAAACGAGGAGCTACGGGAAAAAAA
GCGCAGTCGAGCTCACGTCGCGCTCTCTGTATCTGTCTGTAGAGCTCCGAGCCCAAGCCACAGCATCTTCTTCTCTCTCTTCTCCACCACCACTAGCGCA
GTATGAAGGCGTGGGCGGTCAAATCCGCGGTCGTGACGGCACTGCTCGCGACGGCGGCAGTTGTGCTGACTGACGCGGCGTTCTATGTGCCCGGCGTGGC
CCCCGAGTCGTGGGCCGAGGGCGAGTCGCTGCGCCTCAATGTGAACAAGATCACGTCCACGAAGACGCTCGTGCCGTACGAGTACTACTACCTGCCGTTC
TGCAAGCCGATGAAGACGAACGAGCAGCAGGAGAACCTGGGCGAGATCATGGCGGGCGATGCGATCATGGACTCGCTCTACTCGCTGCAGATGGAGAAAG
ACGCGCGCTGCCAAGTGCTCTGCGAGCCCGTGACGTACACGGCGAAGGAGTCGCAGAAGTTCATCGACATGATCCAGGACGAGTACTACGTGCAGTGGAT
CGTGGACAACCTGCCGGTGCTGTACCGCGACCCGTCCGAGAGCCCAGATGCGGGGTCGTACAAGCGCGGCTTCCCTGTGGGCGAAGTGGACGAGAACGGC
AAGTACTTGCTGTACAACCACGTGCGCATCGTCATTTCGGTGAATCCGGACCCGTACGCGACCACGGAGGAAGGCCAGCAGCCCAAGTGGCGCGTGGTCG
GCTTTGAGGTCGTGCCGACGTCGATCAACCACAAGTACGAGAACGATCCGAAGGGCGGCCAGGAGCTCGAGTCCGACACGTGCGGCAAGTTCGTCAACAT
CGAGGAGGTGGCGCAGGACAACTACCAGTACCTGAACGCCAAGGGTCCGACCAAGGTGCTGTTCACGTACGACGTGCAGTTCGTCAAGTCAGACATCCCA
TGGGAGGAGCGCTGGGACCGCATCATCAGCTCGAAGAGCTCGAACGATCAGATCCACTGGTTCTCGATCATCAACTCGCTCATGATCGTGCTGTTCCTGA
CGGGCATGATCGCGATGATCATGCTGCGCACGCTGCACCGCGACATTGCGCGCTACAACGAAGTGCAGACGACCGAGGAGGCGCAGGAAGAGAGCGGCTG
GAAGTTGGTGCACGGCGACGTGTTCCGCCCGCCGCAATTCTCGCCCATGCTCTTCTCGGTGTTTGTCGGCACGGGCGTGCAGGTGTGCGCGATGAGCGCG
ACGACGATGGTGATCGCGCTGCTGGGGCTGCTGTCGCCGGCGAACCGCGGCTCGCTGCTCACGACGTTCCTGCTGCTGTTCGTGTTCATGGGCAGCTTCG
CCGGCTACTACTCGTCGCGCACGTACAAGATGTTCAGCGGCAAGGACTGGAAGTACAACACGATCCTCACGGCGGTGCTCTACCCGGGTCTGCTCTTCGG
CATCTTCTTCATACTGAACCTGTTCCTGTGGGGCAAGGCGTCGTCGCAGGCTGTGCCGTTCGGTACGCTGTTCGCGCTGCTGGTGCTCTGGTTCGGCATC
TCGGTGCCGCTCGTGTTCCTTGGCAGCTACTTTGGCTTCAAGGCGCCGGTCGTGGAGCAGCCCGTACGCACGAACCAGATCGCGCGCCAGATCCCCGAGC
AGGTGTGGTACCTGTCGTCGCCGTTCAGCATCCTCGTGGGCGGCATCTTGCCGTTCGGTGCGGTGTTCATTGAACTGTTCTTTATCATGTCGGCGCTCTG
GCTGCACCAGATCTACTACGTGTTCGGCTTCCTGTTCATCGTGCTGCTGATCCTGGTGGCGACGTGCGCGGAAGTGACGGTCGTGATGTGCTACTTCCAG
CTCTGTGCCGAGGACTACCGCTGGTGGTGGCGCGCGTTCTTGACGTCGGGCTCGGCGGCGCTCTACCTGCTCCTCTACTCGTTCCTCTACTTCTTCACGA
AGCTCAACATCACGGCGTTCGTCTCGGGGCTCCTCTACTTTGGCTACATGAGCATGATCTCCATCACGTTCTTCTTCCTCACGGGCACCATCGGCTACTT
TGCCTGCCTCTGGTTCACGCGCAAGATCTACGGCTCGATCAAGATCGATTAGGCTTTTGACGTAATGAATGGGTTTAAGGGAGAAAGAACCAGACGGTGC
TGTCTGTGGTGATCACTCGATTGCAGAGTGTGGTCATCCCTTGCATTTGGTAGATTTTCAATACATTTGTGTTTTGGAGAAACGGTGCTGCTCTTCACAG
CCTTTTCGGGCACCCTCATACATGAAAATGGTTCCGTCGCTGTTCCTCGTCTTCAAATACATTATTAAATGGTTCGCCAGTCTGCGACCCACGGATACTT
CTTCACACAGTCCTTGGCTTGCTCGCGCCACAGCTGCACGCGCTCCACAGTGACTTCTTCGTGGTTGTCGCCCTGGACTGCGTCGTAGATGAGGTCTAGC
GGTGTGGTGACCAAGTCCGCCGGCGTTCCAAGCTTCTGCAGCTCCAAAAGCCCCAACAGATCCGAATCCTCGACGATCTCGCTCATCAAATCGTTCACTT
CGTCCAGACGCGCCTTTGCGAAACAAATTGACAGCCAACAACAACACTTAGTGGTTGTTGCGAACACTGAGACTTGATACAAAATTGAAATGATAGTGGT
ACCTCATCGATCATGCTGGTCAGTTTTTCTTCCAAGATCGCGTTCGAAGAAGCCTCCAGCGGGTTCACGAGGTGTTTCAGCGTCTTCGCGGGCGTTGTGT
TCGCAAGGTCTTTCCGCGTGTGAATGTGCGCCTTCGACAGCACAAGCGCGATCTTTTTTCCCGCGATCTGCTCGATCTCGTCGTCCACAGCGTCGCAGTT
ACCGTTTCGGCCAGCGTTCGCAAGCTGCAGCGTATTCATAATAGACAACCAAGCAGAACAGTCAGAAATACAACACATCCGAGCCAGTATTCAACATATA
TGGGCTGTAGTCACTCACTTTTGCGCAAGTCCAGTTGTCAGCACTGATATCTGCAAGCTCCGTCTCGTCACTCGACAGAATCCGCGCTTTGTTGCAGGAG
TCGCAGTACACTGTTGTTGTGGGCTCCACTGCTTCATCGTCCGTGTCAGGTTCATCACCATCGTCTGCAGCAGCATCTTTTCCCTTCTGAACAGTGGCTT
CCTGCTTGAAGGCAGTGACAACATCGGCGGTTTGAGCAGCGACGTTGAATCGCGACAACGCTGCTCGTGCCGTGGCTTCTCGCAGCGCTCTCTGGATCGA
TGTCCTGTCTGCCGCTCTCGCTGGACGTCTAACTGAAGCAGCAGCACTTCCACCACCAGCAGCAGAAGATACGGCAGACCGCGTTTGTCGAGAAAGAGCA
GGAGCTTCCTGGCTTTCGTCTTCGTCAGTGACAACGACGTTACTCTTGTTTGGTGATGTTTTAGAGGCCTCGAGCACGTGATTCAGCTGCTTCTTCGCAC
GACCCTCCTGCTTCCAGAGCTTCCACTGCTCTTCGTTGGCCTGCAAAACAGTTGGAACGAATGTTAGCACATCCTGAAAGGTGTTACAAGTCAGAATACT
CCCGTGACAAACGACTCACCTTTGCCTCAATAGCTTTCTTCGACATTGCTCTGGGACAAAGTACGATAATCAGTTCGACTCAAGTGTTCATACCGCCACT
AAAGAACACTGATAAAGCCAACGCACCGCGTTCGAATATCCAAGTATGACCAGTCTTCCTCAGGCATCAAATCTGCCAGCCCTCCTGCCACGTCGCCATT
GTACAGCCTCGCGATGCTCCAGAACACTCTAAAAAGTAAATGATCAATGAGAAAACACACCGGGAATCGTCCTTGCAAAGGAAATAGACTCCGCAGGAAA
ATGAACCTCACCTGGGCGAGCACTGCGCCATGTTGAACGGCTTGAGCATCTCCTTCCCAGTCT