Description :
From Genome Similarity Track
Location :
Scaffold_1005:2260- 4206
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1005-fgenesh-gene-0.0Transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
1946 bases(100 bases per row)
GCCCATTCGACGGCGAACTCAAACACGTCAAACTTGTTCAACACGATGCAGTTCGATGAACGCTCACTAGCGGATACGGCAATGGAGAATGGAGTCTACG
AGAGCACGCGATCCTTGAACGGAGACATGTACAGTGCACTGGACATCACTGGGAGTAGCAGAAGTGTGAACGAGTTCGCGCGACTTGGGCCTCATCGTCA
GCGGTCCCTTGGGGCCGGTGGCTCCAGGAAGAACGTTGGCAGCGGGCGAGAAATTGGCGGCAGCTTTTACAGTCTCGATGCGGGCGGTGGCGGCCTGAGT
CGCGTTAGCAGTGCGAGCAGTATGAACGACGACTTCACCGAGTCTGAGAGCTGCAACATCAACTCCGACAGCATCGTACTCGACACGGGCGGCTACTACT
TTCACCGCCCCGAAGAACCGAAGGACACGCCTCCGTCTTCGTCTGTGGCGAATGGTATCAGCAACATAGCGGCCCCAACACCTCAAGATCTTCGCGGAAG
TATCCTGGAAACTTTCCAGGAACTGGAGAGCGCCACTGCTGGAGGCGAGCAGTTTGTGTTCATCTGCCATGGCGACCACCATGGACAGTTTGTGAAGAAG
CTGTGCGTCGACCTGTGCCGTGACGGCGGCTTCCGCTGCTATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCGTCTCCAGAAGCTGCCGTCTAGGATCGAGGAAGGCATCGAGGAAAGCGAGCGATTGTCGTCTTCTGG
GGCGTCAGTGATGCCGACGGATGACACCATGTCACGACGCATCTTGGAGGCCAAGGAGGCAATTCTTAAGTGCTCAGCGTTCGTCGTTGTGCTGTCGGAG
AAGACGCTGACGAGCCAGCTCGTGAAGGACCAGCTCGCGTTCGCAGAAGACAAGGGCAAGCGGATCATGCCGGTGGTCGTAAACGACCTCAACTTTGGCC
TCGACATGAAGTACAGTCTCTCACGCAGCGACTTCTACCACTTCTTCAGCAAGGGCGACATGATGGGCTTCGACAAGTCGCTCGGGCGCCTGCTGGATGC
ACTGCGCGAAGAAGTGTACGGCATCACGGTGGACAAGTACGACGCCCCGAAGGCCAGCAGCAACACGGACCAACTCTCGAACTATGGTGGCAGCAATGAC
GAGCGCAGTGGGGTCCACGACAGCTTCATCTCCGTCAGCAGCAACGGCTCGATGCTCAGCTTGTACGGCGGTGCGAATGGCTACCCTGGCAGCGTTCGCC
GCAGACGCCTCAGCACGCAGAGCGCGGGCATGGGCAGCGATCGTGGCGCTGGCGATCTGCACCCTTCGTTCGGCATGGGGTCGAGTCGCCAGTCGCAATC
GTTTATTGGTTCCTCGTCGTTCGTCATCCCCTCGACGCCGAGTGGTGGGACGTCGAGTTCGCGTGGTATCACGTCTGACATGACGCAAGCGATGATCGGC
AACTTCTCGTCGCTCATGGGGCGCATCTCGGACGACCTCGACGAAGAAGCCTTCGACGATCTCTCGTACGCCGGGGTGCAGGGCGGTGATGGCGACAGCG
ACAGCGAGGACGACGACAGCGAAAGGGGGCAGAAGGAGCATGTCGTCGCGCCCGACAATCCGCGACTGAACCACTTTGTGGACCTCATGGACGTGACTGA
GTCATCCAAGGCGCGCCCGACCTCGGCATCGTCCATCAGCATCCTCGAGCGCAGGTCGGACGAGGTGACCATGTCCATCGACGCCATGGACACGTCCAAC
CTGTAGGAACAAACTCACACAGTAAGCTGATCAAGTGGCCGCCATC