Description :
From Genome Similarity Track
Location :
Scaffold_1098:226- 3856
Transcript NameFunction/comments
Phyta_totarag12032hypothetical protein

Sequence
3630 bases(100 bases per row)
GACGTNTCAACTATTACAGTCGTTTCGTTGAGGATTTCTCGATCTACGCGTCGGTCCTGTACGAGCTCCGAGAGGCTGATTTCTATGAGATGGCGCGAAC
ATCGAAACTGGGCCCGGCGTCTGGGCAGCCAAGGACGGCGAAGATCAACCCACAGATGACAATGACAAGTGGAGTCGAGCTGTCGCAGCTTTCACAGCAC
TGTAGGACAAAATCGCGACAGCTCCAAgtttgcagcacttcgattAAGATCGAAGaccggtggtggtggtatATGCGAGCAAGTGGGTGATTGCGGCCGC
GTTGATGCAAGAACATGAAGGCGTATATAAACCCGTGACGTTTACTAGCCGGGCGCTCAAGGCTAACGAGATCAATTACGGGATTGTCGACAATGAggtt
ctcgcgctgctcggGGTGCTGGATGCCTACTACACGCAGTTGGTGACGACATCGATCAAAGTGATGACTCGACACTCTACGTTGGCGTGGCTGGTGCACT
CATCAGGATTGCAAGGACGACTCGGTTGCTGggctgtgctgctgtcagGCTGGACCATGGAGATCGTCAAGTATGACAAGGGTGAGGACGAGATCCTAGG
CGTAATGGCCGCGAGCATCATACcacgtgaagaagtcgatgTGATTTTGGTATCAATAGCACCCAGGAAGCAGCCTCAACAGGAGATCACAATTCCGCCC
CCCCACAGTGGACGTGGATGCGAAATTGCTAGTGGTCAGTTTCTATGGATCAGCTCGAGTGAAACGGAGAGGAAGATAATACAGTGCGATTGTATGGAGG
CTACCGGAATGGAAGGTGATCTCAGCTGCGTCGCAGTACAACGGTTAATGAGGCGGAATATCATGATCTGCTGCTATGTTCCGTTCTTCTGGCCGACCTg
gacgggggggggggctaaTCATCTGCGGAGATTCGAACTTGGTCACCGGGTAGATGCGAGGTGAGATCGAATGCATAGCACCTGGATTGAAGTTACTACG
ACAACAAGCTAAGCTCTTGGCCGAGGCACGAATTCATTCATAATAAGCGCGACTAAAACCAGAGCGCATATCGATTCGCGagtgctgctcttcaacgcga
agaaggcgcgaTAATAACGTCAGAAGATGCGTTCCAAGACTTGATGACGTTTAACCGTCTCAACTCGATGCTAGTGCCACGATCTGACGATTCAGTGACC
AAGATCACAGCCGTGACGAGATCGCACAAGCGACGCAGTCCGGAAGTCCTACAGGGGGAGATTGTTCATCGAATGAGGGAAGAACGAATTGGTCTGGCCC
AAGACGAAGAGAGGTGGGTTGTCGATCTCAAAAAGAATTTGCATTGGGATGTACTGGATCTCACCCCACTGGAAGCCAAGGACTGCGCTAAGATCGCTGA
AGATTACGAGATCGATGAGGCCGGACTGTTGTTTTACTGCCAGTCATTCAAACAGTCGAATGAAGATCGCAATCTCGTTGCTTGACTTGTGATTCCTGGA
ACGCTGCAGGAAGATTGCCGGCATCATTACCATGTCAGCCTGGAAGGTGGACGTCAAGGTATCGGGAGAACGTACCAGCGGATCAAGGCGCACTTCCACA
GGAGAGGACTGTATCAGGGTGTACAACGCTACGTGGGTCAGTGCACCGATTGTGAGACCGGAAAAGGGAGACCGACTGTCCGAGGTGAGTCGCCGGGCAA
CCTGCAAGCGACATACCCATTGCTATGGACCACATCCGTCGCTGCCGAAGTCGTACAAGGGCAACACTGAATTGTTGATCTAGGTCGATCTCCTCACAGG
CTTCGTGATCGTCAAAGGCAAGTCATCATGAACTGCTCAGACGATCGCGGAGAATTACGAGGAATGCGTTTTCCGACGATTTGGCGCAAATGAAGCAATC
GGGCAAGTTCGAGAGCCAGGCTTTATGTCCGACTACTTCAGATCGGTCAACAAGATCGTCGGGCAACGGCAACGAGCGACTATGGCGTATCGCCCACAGG
GGAATGGCACAGCCGAAATGATGGTTCAGACACTGACGTGAGCACTCAAGATATATGTCGCGGACGTGAAACAGAAGGATTGGGATGAATACGCGGAGAG
CCTCATGTTTGCTCTCAACACAGCTCACGATCGAGTGCGCGACGTCACGCCTTTCTATCTGGCGCACGGATGGGACCCAAGATCGACGCTGGAAGCGATG
CTCCCGCTGGGATCGATGCGACGCCGAGATCGTGACTCTCGAAGGTGCCGCTACCATGTTCAGAAGCACTACCAGCAGGCGGGTGAGCAAGTGACGAATG
CGAAGCTACCCAGAGCAGGGCAGATCATCATATCGACTCAGTCCGTCCGCACGAGATCGAAGTCGGCAACCAAGTTTGGTTGTACCTGGACAGGGTAAAG
GAAGATTATGCACGGATGCTGGCACACATGTGGCACGGAACATTCAGAATGGTTGGGAAGATCGACTAGGATGCCGTGAGACTGGAGACCGCTGGCACCA
CCGGTACCCCGTGGTCCATGTGTCGAAGGTCAAGCCCGTGCGAGACTTCCCgctcgtccacgtcttcGATTAGCCGCCCAAGATTATGATCGGCTCGACT
TTGATGATGCTTTGCTGTCTGAAGATAGCTGGGAGACTGAGCTTGGCGTAGATGAGTGACGCAACACCGGCATGTGGGCTGGACGGCGAACACGGCACAA
ACGAGTGCTACGCGAATTTCTGGTACACTGTAAAAGCCACACCGAGTCGACCTGGGTGGACGAATCCGATCTGCACGATTACTTGTGCGAGCAAGCCAAC
CGAAATTAGTTTGAGGCCAAGCAGTCGCACGGGGAGCAGTAAGGTGGCAAGATCGTGGTGTGAGTTGGTCACCTCGTGAGTGGTTGAGTGAAGTACCTGC
GAGAAGGTCGCAGATCAGGAAAGGTGATGAGATCGTGAAGTGAGTTGGTCACTTTGCGACATATTGGACGATGGACCTGCGGGATTGCCGCAGATCAAGA
GGAAGAGGTGTTCATGAGTAAGCGAACCGATCTGGTAGTAACCGCTGCCCAGGTCGAAGACGGAGACCGCCCATGAAATCTCCGTAAAGAAAAAAAGAAG
ATGACTTGACGAAGAAATGTGGAACGTGGACCAGCGATCTAGTTGACTTCGACAATGATTAAGATTAACTGATGCAGAGTGAAGATCGAGAACTACGAAA
AAGAACGAATTGAATTAAAGATGGAGTTACGACTTGGAGGATTACGCTACAACATTTCGGTGCCCTCGGCACCTGGAATCGAAGATCGTGAACCGATGAC
TGgcagcacgaacttgtccaTGAGAGGAGCAATGTGCATAGCTGAGTGATCAGCAGGGCAGACTCGAAACTAGTTCCGCCATGGCTCTTGGAGGTCGACG
ATCTTGAGAGCGTCTGCAAGCGTTCCACGACCGCTGACCAGTTGCGGATACCACTCCTTGGGCATGAGTGACTTCGGAAAATGGAGGAAGTAAGGGTCGA
GAAGCACATCTAGATCACATCGACGTAAGTACAGCATAGTCACCACGTACCCAATATAATTTTTCCACGCGGCCCCCGAGCGACTTCGCCGTTAACGCCG
ATTCTCATGGTAAACGGCCAGAACAGGATC