Description :
From Genome Similarity Track
Location :
Scaffold_2714:226- 1955
Sequence
1729 bases(100 bases per row)
GGTCCAGGCGGCCCACAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTAGGCGGCAGCATCACCACCAGTCACAAGGCCAGATGCAATCTCAAGCACGAT
GACACGTTGACGGAGGCGGTCAACCTCCGTCTGGGTCCCTGTGTCGGACCCGCAGTCGGAACACTCGGACAGGAGTGGCTCTCGGGAGGCGCCGAGTACT
CGTACTCGTGCGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAAAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAATGGCGTCGCGGTAAGC
GACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTACCCGAAGGCTGTCGCAATCTG
GGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCTGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATTCCGTACCCGCGCTCATCGTGAGCGC
TTGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGAGACAA
CAGCTGATCTTCATGATGTTCCCGTAACTCCGTGGCTGAGTACTTAAGAGACTCCACCCATGCCCAGAACATGTCCTCACAAGAACGCCAGGTGGGACAG
GTCTCGGGCAGAACCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGA
AGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCTATCTGAACAAGGGCACGTTCGTAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGC
CACGAGGAGCGACGAGAACCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTTGCGAGTTGATGGCAGCTCCCTGACTGACGGG
TGCCACCACCGAACTCCCACGCACACGCTGGGCAGTTTGGAAATCTGGTCGAGGTCATTCGTGACCTCCCGGGGCTCAGAGATAGCACCCTCCTCCTCCG
CTTCTTCCTCTTCATCCGAGGAGTCGAAGAGGCCCCGATGGCAGTGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCAGTACGCTTCTTTGA
GGGCTTGGCGCCTTCGGCTTTAGAGCCCTTAGCATGCGCAAGACCCTCGGCAAGCAAGAGACGTTTGCGAGGTTTCTCTTCCTCATCGCCACCGGCTTTG
GGAGCGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGACGTGATCACCGTGATCCCTAGCGAGCGACTGCACGCTGTCGTCCTTGTGCTCGCTG
GGCACTGAGCTGGGCCCTCCCGCAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCCACGA
ACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGTGACGGACTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTC
GGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCTTG
GCACCGCTCTTTGCAGTGCCACGAGGCAT