Description :
From Genome Similarity Track
Location :
Scaffold_1034:226- 1407
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1034-snap-gene-0.4Conserved hypothetical protein

Sequence
1181 bases(100 bases per row)
CGCGGCAGGAGAACGTTTCGCTGCAAGTCGCTGGCCACGGGTGGATCGTCTACTACGACGGACATGGCACGATGTACTTGCTGAAGGCTGAGGATGCCGA
CGAGCTCGACACAACGTGGAACTGCGAGTATGAGTGCGCTCCGCTTGGGGTGGTTCCGTCGCTAGTACTGGCCGCATCACTTGACGACGAAAAGCAGCGA
TGCTACCTGCTCGCAGCCGAGCCATTGAGCACAGCAACAGACAGTGACGCCACGTTTCGGCTGTCATCGGTCGAAGTCTTCACGGTAACTTCAAACTCGA
GCGACCTCATGGATGTTGATGGCGACGCCGTGGGATGGACGCACTCGGCCACTGAGGTCGCGCTTGTTGCATCTCTTCCGAGCTACGTATCGCTGATCAA
GAACCATTTGATCGTGCTGCTCGAAGGCACGTACTCGCTCTCGGTGGAGACCAACGCAGTCGTGTCGGTAGTGGAAGCCGAACCGACATCGAACAGCAAG
GGGAGCAGTGCAGCCTCACCACGCAAGCGACCGCACGGCGATGACGATCTGGACGACGACGAGATGCGCGAGCTGCTGGCCAAGCTCCCGCGCGCGGGCA
TTGGCTTCCACGGGGACATCAAGGACGTCAAGGACTCGAGCGATCTGGCGTCACTCGACTTCAACACTCCGCTGGCGTCGCGGTTCCACAAGTCAAGCAC
GCCGTTCAGCTCTGTATCGGATGAGCCGATGGTGAGTGCGTCGCCGGCTGGAGCCCACGCTAGTACGAGTCCTCGGGAGCGACCGCTGGAGATCCCGACG
GCCGAGTCGATCCTTGGCGGCTTCGAGGAGTGCGACGACCGCGACCCACTCGCCAAGGCCGCGCTGGTGCAACTGGATCTCTCCGAGAAAGTGGCGCGCG
AGCAAGTCGAGATCGACTGCAAAGAGTATCGCTTCCTGTGTCCGAGCGCAGGCAACGCCAGCTCTTCGCGGCCCAGGCTGCTGTTCCGCAACGACGTCCA
CGGACTGGTGTACGACCTCGAGGTGGCGGCGAGCGGCGCGCTGACGCTTCGGCACTCGGCGACGCTGCCAGCGTTCGGGTTCGTGCAGGCGTCCAAGCAG
GAGAAGAAGTTCCTCGCGGTGGATCCCGCCGCGACGTTCGCGTGCATTGGCGAGTTCGAGAAGCGCGTGTTCGTCTACTCC