Description :
From Genome Similarity Track
Location :
Scaffold_122:22594- 24343
Sequence
1749 bases(100 bases per row)
CACCACCAGCAAAACGATGTTCCGACTGCGCTCGAAGTGCTGCTGGACCTAGAGCTTGATGTGCGTAACCTGCCAGTGCTGGAGGACAACCAGTTTGCGC
TGCAAGAGCAGTGTGGCGCATTTGGCGGCAACGACGTCTTGTCGCTGGAGGTCTTGGTACGCAAAAGGCTCGAGAGCTTTCTAGCACTGCTCAGCCGTTG
TGTGTGTGTGCGTTCTGATGCGACGTTCTCCCTTGTGCATATTTAGGCACTACAGAGCCCGCATGGCAAACATCAGCAGTGGGATGACAAGAATTCACTC
GAGAAGCTCTATGCGCCAGAAGAGCTGTCGCCGCACAAAGTGAAGCGCCATCTCCACCAAAGTGAGTGTATTAAACACTTTAACGTCTCAGTATTCATGC
GTGGATCCTGATGTTTGGCTTGTCATAGCTACACTAGGTTTGGTTGGGTCCGACGTCCCGGTTCTCACTTCACCGAGCCACCATGTCACTCCATTCCAGC
CTTCGCCCTGCCACTCAGCTGATGGCGGTGAGTACGACTTGGCGTCGCCGGTTGGACTGCCAGATACCCCAAACGCGAGTCAAGGATCGCCCGTCTCCCG
ATGGGATCTCGCGCCTGACCTGCGCTACGAGGTCGACGACGCGTTCTTTGAGAGCGCGCCACCTCCGCCGCCATCGTCAATTCGAACGCCTTCACGAAGC
GTCGCAAAGAAAGCACAAAGGAACTTGTTCACACGAACCCCTCGGATGTCTCCAACCCGACGCATGACGGTCCACACGCCTGCCAGAGCCCTGCTAACAG
TCCCAGGGATAACAGGACCAGTGTCCCATCAGTCCCAAGCACAGCCTCAATATCAGCAGCAGCCAGCGTCCGTGCCTAAACGGAAAGTGAAGCACGGCGG
GATCTACTCGCTGCTGCTAAAGAACCGTGGACCAGGAGACCACGAACCAGTCCTCATAGACGAGAAGCGCAGCCCCGAAGTCCCTGAAGGTATGGAAGGA
TTCACCTGGGTGTGCAATGCACGAACTCGGTTTGCGTGGTTCTTATATTGTGTCATGTTGTAGATTCGCCAGGAAGAGTGCGCTCTTCTGCAGCGCTATC
ATCCAAGGTGAGAATGGACAGGCAAAATCGCTACTTTCACTTGTTCTGCTGGCATAATGTTTGATTTGCCTTTGCTCACTGATCAAACTGTGTCGATCTA
CTGCTGTAGAAATCCCCGCCACCTGCGCCAGCCACTGCTGGCAAAGTCCAGCACGGAAGCATCTATCGGATGCTGCGACGGTACCCAAACGGAAGCTGAG
CTTCATCTTCGCTGCTGATCACGACATGCTCATCAACGATGAGAAATTGGACAGTGTTGAGTATCAAGTATAATATCGCTAGTTGCAACCGCATGCACTG
CGTGAATGTGGGTATGTGGTCGTGTAAGCACCAGCGATTGTGTGTGTGTGTGGCTTAAGAGATCAAAGTGTGTCACTTTCGCATCTGAATGTAGCCATCC
ATGAGAAAGATGGCTACATTATTAGTATGATTCTTTGCTGTTGTTATTGTTTTGGACTGTCAAGATACATAAACAGCTGCATTTGATGGCGAGCCTCGAG
CACTGACTGTGGCACTATTATGTGGTACAAGCAACAACAGAGGTGCTTTTACTAAGCTATGTGATGAATTTGCCAAGCATCCATCCATCCACATATATTG
CTCCACACACATCATCGATAGTTTGGAGCTAAACATTTTCACTTTGAAG