Description :
From Genome Similarity Track
Location :
Scaffold_943:2259- 4629
Transcript NameFunction/comments
Phyke_g11602hypothetical protein PHYSODRAFT_261658

Sequence
2370 bases(100 bases per row)
tggCGTGGAAATCCGGAGCGGTGTAGCAGCTGCTGTTAATCAGCGTCCAACTATCGTTGCAAGCAACGAACACTCGCGGAGACAGAGCAGGTCATTGCAC
CGGAAAAGGCCTTGACAGCAATCCCTCACGATACGGTCCGGGAGTGAGTTATCCTGAGGATGGGTACCCGCTACATATGTGTACTGTATTTAAAACTAGG
AATAACATGCTTTCTTGCTAGTTTTATCTTTGCTTCAGTATCACTTCTGAACCTTTGCAGGGCCCATCTCTTCAAAACACACAGTGTACTGTGACAGACC
CAGTCAGCTGGCCCTGAGATTGGCGAAAGCGCATCCCAATGCCACGTCTTATTGTTTTCCAGAATGAGCGAGAGCACATCACCTTAAAGCGGGGGAGATC
CTTCGTGGCCAGCGCCATCCGCGCCCGCGCTTTGCTCTCAGGTATTGCTCCGTATCCTCCGtggttgctgtgctgcaaatGTGCCAGAGAATCTGCTTCT
AATCACAACTGATGATTAAAAACTTTTAGTCGACGGCCGCGTCCTTGCACGTCCGAGTTGGCTGAACTTGCAGCGCTTGCTCGTGTTACTCCCATGTCAA
TTGGTCGCTTTGTCGacagaaaaagaagaaggggCAAATCTACATCGGCGGATTTGGCACAGAGTTGATaagttcgagttcgagttcgaggaGCTCTTTA
CCTCACTCACTCTGGAATTTTCCTTGTCTCGGAGAAGTCCCCGCCAGTAGCAGCCGCAACAGCAAGTCTCGTCCGACTGTCTCCTCTCTTCCTTCGTCTC
CACCATGTTGGCTCGCATGTCTGCCTCCCAAGGGCAGGGCGCCACAAGCAACAACTCGAAATCGTCGGTTTtcttcacgatggaggacgccaaggccTCG
TTCAACCTCTTCTGCGCCGTGTGCGGTATCGGTTCGTTGGCCATGCCTTCCAACTTCGCTCGCGCCGGCCCCCTGTACGCGTCCCTCGCGCTGGGCTTCA
TGGTCTTCGCCAACACGTACGCTACGCTCAAGCTGTCTAGAgtgatgctggtggcgcCGTCGTCCGTCAAGACGTACGGTGACCTCGGCGAGTGGGCCCT
GGGTAAGTGGGGCCGCTTCTTCACGGTGGTGTCCCAGATGGGTGTGTGTCTGCTGGTTCCCATCGCTTTCCTGGTGCTGGGCAGTACTCTGCTCGACGTG
CTGCTCCCGGACTCGTTCAGCCAGACGTTCTggatcatcttcatggcgctGACGGTCATGCCGGTTTGCTTGATCCCGACGCTGAAGGAGAGTGCTGGCA
TGGCGTTCGCCGGCTGCATGGGCACGCTGGTCGCAGACGTCATCGCCGTGGCCATTCTGCAGTACAACATGCGTGGCCACCCGTCGATCCCGTCCCCCGA
TGTGACGATGCACCAGGTGATGACGTCTTTCGGTAACTTGGCGTTGGCGTACGGCGCTGCCCCCGTTCTTCCGGACCTTCAGCGCGAGCACTCGCAGCCC
CAGCGTATGCCtcgcgtggtggtggtcacGATTCTGTTCATCTCGGTTTTCTTCCTGGCTATCGCTCTGGGCGGTTACACTGCTGGTGGTTGCCAAATCT
CGGGCAACATTCTGTACTCGATCGTGAGCACCGAGGACCCGTTGGGCCTGGCTCCCCTAGGCTTCAGTGCCGACCGTGGTGCCGTTGTGATGTCCTACCT
GTTCATGCAGATGCACATTTCGGTCGCGTTCTCGACGCTGATGCAGCCGCCGTTCTTCATGGCGGAGCGTCTCATCCTGGGCATGCACGAGAGCCCCGCC
ATTGTGCGTTTCGGTCAGGAAGACGAGCTGGATGTGGATCTGGAGCAGGAAAAGCACTCGTACGTGCAAAGTGCGACGCCCGCCGACCAGGTGGTGTCGA
CGTCTAGtatgatggagaaggcggATGGCCGTATGTCGCACCTGCGCGTGGCGCTCGAGTTCGGCGAGGAGATCACGGAGGCGCAGCTGTCTGCTGAGTA
CAATGGCGCCAAGAACACACTGCGCTACGTCGCTCTACGTATCGCCATCGTGGTGGTCCTGGTGATCACCgccgtggtgctgcaggacaagtTCCTGGAT
TTGCAGGACTTCACGGGCGCGACGGCCCACACCACCAACTGCCTGCTCATCCCTCTGATTATCTACCTGCGCATCTTCTGGAAGAGCACACCCATATACG
AGAAGGTCGCGTCCTTGGTGGTGATCGTCGTGTGTGCATTCGCGGGTTGCTACGTGATGATTTACGCTGGCGAGGAGCTGTTCACGCCGTCGGACGACCA
CACGTTGTTCCCGTACTGTGAAGCCGAGATGCAGGATGTGCCGTACTACGTCcgcaacagcaccaactAA