Description :
From Genome Similarity Track
Location :
contig_96:22585- 24854
Transcript NameFunction/comments
g12772.t1hypothetical protein

Sequence
2269 bases(100 bases per row)
TCTGCTGCAGCCGTCGCAAGAGGCCGCCGAGGTCGTCCTGAGTGCGCGCGTCCATGAAAGGAAACGAACGCGCCCTTTTCGTCCAAGATTGCGGAACGAT
CTGATTTGACGGGGCTGGGTAGAATACATAACATAGGGTGATGTACACTATTTAGCGGCTACCAACAGATCGTCGGCGGAATTTCAACCAATGTCAACTC
GAATGAGATCACAGTTTTGACCAATAGTGGCACTTCCACGACGTCGTGGATTCCGGCTCGCTGTGTTTCCAGAAGTTCAAAGGCACAAAACAAAGCGCAA
GCCGGAGGAGCTTCGGTGCGTGCTACTTTCTTCCCCCGTTCGTTCTGCACGTCTGGTTGTGTGTCTAGCCGCTGGTTAACCCCTCGATCTCTAGTGTCTG
CGTGTGTGTGTGAAACAGCGGCGTCCAGATCTTCCCACAAGGAGATTTAACGTCGGATATAGTGGAAAAGGTACGAAAACGAGAAAAAAACACGGCTAAA
AGGCGCTCAGAGCGGCGTTTAAACAGCTTTCTAGCAGCTATACAAGCTGCAGCAGATCGCCCTGCACCTTGCAGCGTGGTCGCGTGGGGCTGTATGAGCT
AAATGATGACCTCGTCACTGATTTTATGACATTTGTGTCGGTTTTACTCGGTTTTAGCAGTTTCTACAGGGTAAACAAGAACAAGATGGAGGCTATCGGC
CAGAAGCTGCTGGATTTCTCGCAGCCCTTCGATGTGGCGGCGCTGGACCAGGTGGTGCTGTGCATGAACGACCCCAAGAGCCCCACCAGCGGGTGGCCAA
CCAGATCATGGTGGCGCTGCAGGAGCACCAGGACTCGTGGACGCGCGCCTCTGACATCCTGGAGCAGTCCAGTAGCATCCAGACCAAGTTCTTCGGTCTG
CAGGTGCGGTGATAATTGTTGCAGTTGTGACACAATTTGGAGACTCTGACATGCATTTGATGGGCATCAGATCTTGGAGGACGCGATCCGCTACCGCTGG
AAGATCTTGCCCAAGGACCAGCGCGAGGGAATCAAGAGCTACATTGTTGGAAAGCTGCTATCGGTGCGTTGGCGTTGGTTTATTTTTTATGGCGATTGAT
AGAGGTGCTGATTCGGGTGGGGTGTATTGGTTGTGTGCAGCTATCGTCCGATGAGTCGACGCTGCACGGTCAGCGCATGTTTGTGAACAAGATGGACCTC
GTGCTGGTGCAGGTGTTGAAGCACGAGTGGCCGCAGAACTGGCCGTCGTTCATCACGGACATCGTCAACTCAAGCAAAACGTCGGAGATCTTGTGCGAAA
ACAATATGACGATTCTGAAGCTGCTGAGTGAGGAGGTGTTCGACTTCTCGAAGGACCAGCTGACGGAACAGAAGACCAAATCGCTCAAGGAAAGCCTCAA
CCACGAATTCACGCAGATCTTTCAGGTACGATTGAGAGCACGGAGAAAGCGCGGTTCGTGTGGCCACAATCGTCTTCGATCTCAACAACGCTAACGTTAT
GTTTTTATTCTTGCTGTCGATCCTGCTACCGTAGCTGTGCGAATTTGTGCTGAACAAGTCGACACACGTTCCGCTGCTTCAGATTACGCTGCAGACACTG
CTTCGTTTCCTGAGTTGGATCCCGCTTGGTTTCATCTTTGAGACGGACCTCATCAAAATCCTTGTCACAAAATTCCTGGCGACGGGCGTGTTCCGCAACG
AAACCATCAGCTGCTTGAGTGAGATCGCGCAGCTGCGCGACGTCCCTGAGCAGTACAACAACGTGTACGTACAGCTGTACATGGGCGTGCTTAACGAGGT
TGGAAAGATCCTGCCGCCTGGAAATTCGTTCACTCCGTTCTGGGAGCAGGACGAGGTGTTTGTTCAGCGTTTGAGTATTTTCTTCACGAGTTTCTTCCGT
TACCACATCCAAGTTATTGAGCGCCCGATTGCCGCTCCGGGTGATGAAGCCCACCAGGCGCTGCTGGCGGGATTCACGTACCTTGTGTGCATTGCCGAGG
TGGACGACGACAGCATTTTCAAGATCTGCTTGGACTACTGGCATTTCTTTACGCGTGATCTGTACACGGTGGACCAGAACCAAATGAACCCGCTTGCAGG
ATTCCAGAACCAAGCTCGTAGTCGCCGTGAGCTTGTATCGCCCGTGATGAACCGCGTGCGTCACGTAATGATCTCCAAGATGGTAAAGCCGTCGGAAGTG
CTGATTGTGGAGGATGAGAATGGCGAGATCGTACGCGAGACGACCAAGGACACGGAGGCGCTGTCGCAG