Description :
From Genome Similarity Track
Location :
Scaffold_164:22581- 24755
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_164-snap-gene-0.12Myosin

Sequence
2174 bases(100 bases per row)
CGTACGGCATCGAGGACATGATTTCGCTCAACTACCTCCACGAGGCCGCGATCCTCTTCAACGTCAAGACGCGCTTCCTCCAGAACCTCCCGTACACGTA
CACGGGCGACATCTGCATCGCCGTCAACCCGTACCAGTGGCTCCCGGATCTCTACGCCGACGAGCAGCACCTACGGTACCTGAACCAGCCCAAGGAAGAG
CTCCCGCCGCACGTGTACGCGACGTCCGTGGCCTCGTACGACAACATGCGCCGCACGGAGCGCAACCAATCGATCCTCGTGAGCGGTGAGTCGGGTGCCG
GCAAGACGGAGACCACGAAGATCCTCATGAACCACTTGGCCACGATCGCCGGCGGCCTCAACAACTCGACGATCAAGAAGATCATTGAGGTCAACCCGCT
GCTCGAGTCCTTTGGTAACGCCAAGACCGTGCGCAACGACAACAGTTCGCGCTTCGGCAAGTTCACGCAGCTTCAGTTCGACCGCGAAGGCACGCTCGTG
GGCGCCAAGTGCCGCACGTACCTGCTCGAGAAGACGCGAGTGATCAACCATGAGTACCCAGAGCGCAACTACCACGTCTTCTACCAGGTATGGCACATGA
TGCGGACTTCTTGCATTATCAGTATGAGTTGCAAGTCTTCATATATACTAACTGTGTGGATGTGTTGCTTTGGATAGATCTTGGAAGGCGAGATGTCGGC
TGAGCTGATGCTGGACTCGTCCAAGACGTACACGTACACGGGCAGCAACAGCGCGCAGAAGATCGAGGGCATCTCGGACGCCAACCACTTTAACAAGACG
CGCGTGGCGCTCGAGCTCATCGGCCTCACGCCGGACGCACAGAGACCGCTCTTTGAGGTCCTCGCGGGCGTGCTTCATCTCGGCGAAGTCTCGCTGCTCT
CGAACCCTGCGAATGATGAGGAGTCGCGGATCACCGAGGCCGATGCCGGCGCGCTCGCGTGCGTGCAGCTGCTGGGCGTGACGTGGGAAGCGATCGAGAA
GGCGCTGTGTTCGCGCACGATGCGCGCCGTGAACGACGTGTACAGCGTGCCGCTGCGCAAGGAGCAGGCCATGGACTGTCGTGACGCGCTCGCCAAGGCG
ATTTACTCGAACGTGTTTGACTGGCTCGTGGACTCGATCAACCGCTCGCTCGCGGACGACAACAACATGTTCAACCACGTCGGCGTGCTCGATATCTTTG
GCTTCGAGCACTTCAAACACAACTCGTTTGAGCAATTCTGCATTAACTACGCGAATGAGAAGCTCCAGCAAAAGTTCACGCAGGACGTGTTCAAGACCGT
GCAGATCGAATACGAAGAGGAAGGCATCACGTGGAACCACATTGAGTACGCGGACAACCAGGACGTGTTGACGGTGATCGAGTCCAAGATGGGCATCATT
TCGCTCCTGAACGAAGAGCTCATGCGCCCCAAGGGCAACGAAGAGTCGTTTATGTCCAAGGTCGCATCGCTGCACAAGGAGGACATGGCGCACGTGATTG
AGTTCCCGCGCACGTCGCGCACCGAGTTCCTGATCAAGCACTACGCCGCGCCGGTCATGTACGACTCGGTGGGTTTCCTAGAAAAGCACAAAGACGCGCT
TCTGCCGGACCTGTCTGAGCTCATGCGTAGCTCATCCAAACCGTTCATCGCGGCGCTCTTTGAGCCAAAGCCTGCGCCGAAGGTGGTCGCGGCCGATCCG
AACGCGCGACGAAAGCGAGGTGGCGGCGGCGCACTGACGCTGTCGACGGTGGGCACGCAGTTCAAGGAGTCTCTCGCGGAGCTCATGACAACGATCAATG
CCACGAAGGTCCACTACGTGCGCTGCATCAAGCCCAACTCGATCAAGAGCTCGACGACGATGGACCAGACCATGGTGGTCGCGCAACTGCGTTGTGCAGG
TGTGATTGAGGCGATTCGCATCTCCCGCGCGGCGTACCCAAACCGCTTGCAGCACACGGATATCCTGGACAAGTTCTGGCTGTTTGTGCCTCGCCAGGGT
GAGACGGCGCGCGAGAAGTGCGAGCTGCTCATGGAGAAGCTCAAGCTCTCGACCCCGGAGCAGTACCAGATGGGCAAGACCCGCGTGTACTTCCAGCTGG
GAGTGCTTGAAGAGCTCGAGGACCGTCGTAAGAAGTTCCTGGACGCCAAGGCGACGTACGTCCAGGGCGTCATG