Description :
From Genome Similarity Track
Location :
contig_47:225762- 227359
Transcript NameFunction/comments
g7858.t1DEAD/DEAH box RNA helicase, putative

Sequence
1597 bases(100 bases per row)
CTAGACAAAATACTTCCTCGAGTTGCTCACATTGAAAAACGCACTGACGGTGCACAGATGATGTTATCGCAGCAGAGACAGCAGATGTACGAACGAGCTC
TGGTACGATATCCGCAATGCCGAAGCAACGTTTTTGCTCCCAGCATGTATGATCACGAAGAAGTGTCCAACTTGGATGCAGGCTCAGCACCTCAGGCACC
CCGAGCGTCACTAGAGCTTGATTTCGTATATGGATGCCGAAGTGGAGCCACGACGTCGCTTTCCAGCAGCCATCCTGCAGCAGCACCTAACACTAGTACC
AACAACAGCGCTTTCTACCTGTCAACTGGTGAAATTATGTGGTTCGCAGCGACGTTAGTGATTCTTTACAGGAAAGAAGCCAATACCCAGAGGTATTTCC
GGGAGCACACGAACGAGGTGACGAGTATAGCAGTTCACCAGAACCAGCGCATTGTAGCATCCGGCCAAGCAGGACGATCGGCGTTTCTCTTGGTATGGAA
TGCGAACGATGAACCGCTGGGCAAACGGTTTGCGTGCCTCAAGGGCCACCAAGTGGCAGTGCGCTCCATCAGTTTTTCTCATGACGGTAAATTGATCGCT
TCGTTGGGTGGAGATATGTACAACACCATTTGCATCCACGACTGGAAGGCGCAAGAGTTATTGGTAAGTGCTCGGGGCACACGTTTCGGGTTCATGCGGT
TGCATTTAATCCTTTTCAGGCATACGGTCGGCCAGAAACTCAGCGATCAAAGAAACCTGGCCAAGCTTTGCACGATGACGATGCATGCTACACCCTAGCA
AGCTGCGGCGTCCGGCATATTCGCTTTTGGACACTGACAAAGTGCGTGCCCCCTCCATCAAAGGAAAATGTCGACAGTGCATTTTCACGCTCTACATTTG
GTGGTCCTCCAAGATTGCGTCCTCCAACACCGACTGAGAAGGTCTGGAAGCTGGAAGGCAATGTTCCATCGTTCCATGGTCGATTTGAGGTTCAGGACTT
TACAAGTTTAACGTTTGTGAACGATTCACCACCTCTGTATATGTATGATGAACACTCCAAGGAGTTGACGGCCACAAACGCTACTGATCATTCGCTGGGT
CGGATCGTAGCTGGCACGGCTAACGGAGATCTGTGTCTGTTCTTGCAGCCAAGGGCAAGCCCCAATATTGATTTCGTTTCCGAGGGTGATCTTCACAAAG
AGCCTGCAAAATGGTGGGAAGTTCCAGACGAATACACTGATGCTGAGATCAACGAACTCGTATTAGAGAAAATCGCATACGAACCAACAGCGAGACTCAT
TGATATCGTGCCTCATGACCAAGAAACTGGTAATCGATTTAAACTACCTAAACAAGCTCAAGCGGAGATGCAGAGTTTATCCAAGAAAATGGCGTTGAGG
CCCAACTCAACGGCCTTGTTCTCACGGCTGGGTGAACTAAAGTATAGCGGTCCGTTAGCTCACCAAGGAGCAGCTTACCAGGTGGCGTACTCCAAGAAAC
GCAATACGATTATTTCATGCGGAAATGAAGGCAAATTGCTGCTGTGGAAGTGTGAAATGAGTAAGCCGCTACGAATCCCTGGAGTTAATACGTTAGG