Description :
From Genome Similarity Track
Location :
Scaffold_410:22576- 23870
Transcript NameFunction/comments
Phypl_g8005ABC transporters ABCA family

Sequence
1294 bases(100 bases per row)
acccgccgcagctcgtttTGATCGAGCACCCGTACAAAGTCGCATCTCCAGCAGTAGGCGGGATGAGACCCGTGAGCATCGAGATAATTGTTGTTTTACC
CGCTCCGTTGTGGCCCAGAAGCGCGGTGATCTGGCCGCTGTACATGGCCAAATCCAAACCAGCAACCGCAACATGctcttcgccatcttcttcaagcGGA
AACACCTTGCGCAGTCCGCGGATCTGGAGGCAAGTATCATTGCGCTCCTGCATCGCTAACGCCGCGTTGACGGGCTCTACGTACGCGCTCCTCGCCACTG
GTTCGAGCGCCTTGGCAATGTTGTCTCCATCCGCAAGTTGCGTGTatgcaccaccagcttgagGAGACAGTGTCGGAGACGCATATCCGTCTGAGCTCGT
CGGCGCGTCCTCTTGGGCAGCTTGGTCGATCTTGTTCTGCCAGTAGCTCTTCGTGAACAAAAAGTACCAAGGCTTCCTCACGCCGTATTGCTGAggcagc
acctgctcgagGTACCATCCCAGCGCCACAAGAAGGACCGAGTCAAGAATCAGAAACAGACTCATCCGAAAGGCACTGGGGACAGTCACGGGCCCTTCCC
GAAGACCAACAGAGTACGCGAAAGCTGAGCACGACGCAAAATCTCATCCACCGCGAGCGCAAACGCGGTGGGCGGGGACAGCGCGGCCCAATACCGCGGC
GCGTTCGTGTCTGCAGACTGTACCGCGAAGAATGGGAAGAAGAGGATAAGCCACAGAAGCACCGACgcgatggcagcagtgcgGGATTTGTTGAAGAACG
GCGCCACGAAGTAGGAAAACGCCGTGATGGCCACGCTCAGCGCCCAGAAGAGGAACACGAGCGTCGCGTACTCGGTCGTAGGGAACACGTTTCCGTACTT
GAGCTCGGCCGAGATGGCAAAGGCCagcggcgtcgccagcaccaccgtcgtgaggcaccacgagcagagcagcgcggcgtctgAGAGCCCCATGATCTTC
ATCACCTCCCGCAGTCGGTTCTCCTTCTCAATCAccatcgtcgtggtcgtcgtggacacAAACTTGATGTAACTCACAAGGAAGAAGAGCCCCAGCATGG
ACTGCCCGCCCGTGTAGAAGGACGTCATGGTGGACGACGGGCCTCCGATGGCCTCGAGCCCCCACACCGCCAGGTCACTGCAAATGAGCGTTTCAttggc
cgccagcaccgccgcttCCGACGTGAACCACTCGGATCTCCAGCCGCCTGCAAGGTTGTCCaggttggccagcagcacgggcagGAACAGCTCC