Description :
From Genome Similarity Track
Location :
Scaffold_410:22571- 23803
Transcript NameFunction/comments
Phypl_g8005ABC transporters ABCA family

Sequence
1232 bases(100 bases per row)
CAATGacccgccgcagctcgtttTGATCGAGCACCCGTACAAAGTCGCATCTCCAGCAGTAGGCGGGATGAGACCCGTGAGCATCGAGATAATTGTTGTT
TTACCCGCTCCGTTGTGGCCCAGAAGCGCGGTGATCTGGCCGCTGTACATGGCCAAATCCAAACCAGCAACCGCAACATGctcttcgccatcttcttcaa
gcGGAAACACCTTGCGCAGTCCGCGGATCTGGAGGCAAGTATCATTGCGCTCCTGCATCGCTAACGCCGCGTTGACGGGCTCTACGTACGCGCTCCTCGC
CACTGGTTCGAGCGCCTTGGCAATGTTGTCTCCATCCGCAAGTTGCGTGTatgcaccaccagcttgagGAGACAGTGTCGGAGACGCATATCCGTCTGAG
CTCGTCGGCGCGTCCTCTTGGGCAGCTTGGTCGATCTTGTTCTGCCAGTAGCTCTTCGTGAACAAAAAGTACCAAGGCTTCCTCACGCCGTATTGCTGAg
gcagcacctgctcgagGTACCATCCCAGCGCCACAAGAAGGACCGAGTCAAGAATCAGAAACAGACTCATCCGAAAGGCACTGGGGACAGTCACGGGCCC
TTCCCGAAGACCAACAGAGTACGCGAAAGCTGAGCACGACGCAAAATCTCATCCACCGCGAGCGCAAACGCGGTGGGCGGGGACAGCGCGGCCCAATACC
GCGGCGCGTTCGTGTCTGCAGACTGTACCGCGAAGAATGGGAAGAAGAGGATAAGCCACAGAAGCACCGACgcgatggcagcagtgcgGGATTTGTTGAA
GAACGGCGCCACGAAGTAGGAAAACGCCGTGATGGCCACGCTCAGCGCCCAGAAGAGGAACACGAGCGTCGCGTACTCGGTCGTAGGGAACACGTTTCCG
TACTTGAGCTCGGCCGAGATGGCAAAGGCCagcggcgtcgccagcaccaccgtcgtgaggcaccacgagcagagcagcgcggcgtctgAGAGCCCCATGA
TCTTCATCACCTCCCGCAGTCGGTTCTCCTTCTCAATCAccatcgtcgtggtcgtcgtggacacAAACTTGATGTAACTCACAAGGAAGAAGAGCCCCAG
CATGGACTGCCCGCCCGTGTAGAAGGACGTCATGGTGGACGACGGGCCTCCGATGGCCTCGAGCCCCCACACCGCCAGGTCACTGCAAATGAGCGTTTCA
ttggccgccagcaccgccgcttCCGACGTGAA