Description :
From Genome Similarity Track
Location :
Scaffold_405:22570- 24234
Transcript NameFunction/comments
Phyag_g5430UDP-glucuronic acid decarboxylase 1

Sequence
1664 bases(100 bases per row)
GGAATGAAAATTAGTTACAAATTTCAACTTTTTCTCACCTATACATCCTTCAAGTGAGCAAACAGGCTACTCTATAGTATATTTCGAACGCCACAATGTG
ACAAAAATATATCggctctctctctctcgtttttcttcttcatttttgAATAAGACACCCAAGCCAGCAATAGCATCACCGGAAGCTCATCTCATCTCAC
CTCTCCCCGTTATATACTGCTGCGATGGCCCCAACTGCCTCAATCGCGTCGCCGGAGATGACCCAAACTGACGACCACCACGTGTCCATGCCAATGCACG
CGCCGCCCGCGCCGGTATCGCCCGTAGCCATCGTCCCGCGCGAAGAGCCCACTCCTCCTCTGCGCCGTGCGCCCGTGTCGCTGCCtcgccaagtgcagca
gtgCACCATGCAGCGCGTCCTGGTGACGGGTGGGGCTGGCTTCATCGGCATCCACTTGTGCCGGaaactgctggagcagggCCACGAGGTCATTTGCTTG
GACAACCTCTTCACCAGCCAACGGGCCAATGTGTtagagctgcagaagcagtaCCCAAGCTTCGAGTTCGTGCGCCACGACGTCACGGAGCCGTACTCGT
GCGAGGTGGACCAGATCTACAACTTGGCGTGTCCGGCCTCGCCTGTGCACTACCAGTACAACCCCATTAAGACCACCAAAGTGTCGTTTATGGGGGCTAT
GAACATGCTGGGATTGGCCAAGCGCGTCAAGGCGCGTGTGTTCCAAGCGTCGACTAGTGAAGTGTATGGGGACCCAGAAGTGTCTCCGCAGGTGGAGTCA
TATCTGGGCAATGTGGACTGCACGGGGGTTAGAGCGTGTTACGACGAAGGCAAAAGAGTGGCCGAGACGCTGTTCTTCGAGTACCATAGGACGCTGGACG
TGGATATTCGAGTTGCACGCATTTTTAACACGTACGGACCGGGGATGCACCCGTACGACGGACGGGTGGTGAGCAACTTTATCATGCAGGCGCTGCAAGG
CGAGGACATCACGATCTACGGATCGGGAAACCAAACGCgctcgttctgcttcgtggacgacctTGTGGAAGCTATTGTGCGCTTCATGGACTGCACCACG
TCTGTGGGGCCGATGAACCTGGGTAACCCGCACGAGATGACTATCCGCGAACTTGCTGAGATGATCATCCGGTTGACAAATTCTCAAAGTCGGTTGGTGT
TTCGGGATCTGCCCAACAATGACCCCAAGCTGAGGAAACCTGATATCACCCTTGCCAAGTACGTTACGGGGTCTTTCGACGCTATGGACGCTGTGGGCGA
TGCTAACTTGTGTTATTTGTTGTTATTGCAGGACGCACTTGAATTGGAACCCTCACGTGTGCATCGAAGAAGGACTGATGCGCACCATCGCATATTTCCG
GGACTTGGACCTATCCAAGTACAAGCGACCGACAAACAACACAGCGCATCGAAAGAGCGAGATGGCGAATTTGGCAAAAGCAAGCTGCCGAAACTAAAAT
CGCCACCTATGGCCCTGCCGTATTCCATACATGAATTTCTGCGTGCTGGACACGTGCTAGAGTTGAGGAGCTATTGAGAGTTGCAAGAGTGGCGGTTTGG
TGCAGTAAGAGCCATGGAAAATTAGGGATTCAGCCGTCGCCGGCAAAACTACACGTCCAAGTAC