Description :
From Genome Similarity Track
Location :
Scaffold_1314:2257- 3480
Transcript NameFunction/comments
Phyag_g10255lipid exporter ABCA1 family

Sequence
1223 bases(100 bases per row)
CGATAGAGGCACTCGAAGGCGCATTTTCAAGTTTCTTCTCAGTGAATAAGAAGACCAGCCACTTGAGCATGTGTTTTAACGCGTAGGTGCTTGCACCGCC
ATTTTGTGAGAATGAGACGCATTGCGTTTGTATCCGCGTGCTTCTACCATGGTTCTCGTAGAATTTTCAGTGTCATTGTGCAGCATTTACTCTTGTAGGA
CTGCGGATGCATTCTGGGGATATGTACAAGTCATTTTGGCTGAAAGGCCAGCAAGCTGCTCTGTATGAAGTGCAACTTATGAGTGTCAATGCCTACAGTC
TATTAGCCGCCAATTCCACGCGCCACGCCCTTCTCCTCGCTTTGCTGGCCTGCGAAGTTGTTGAAGATCTGCTCAAGTGTGGTCTGTGAGACGGCGTACT
CTCGGATTCCTAGCTGCGGCTTGCTGCCCTCCACTCGCCGGAACACATTCGCCAACCGCGGCACTTGGCCCGTGAGTTTATAGCGACAGAGATCGTTCtg
tcgctcgagcagcttcacacCAGTACGGCCTTCTACTTCGAAGCTCTGACGGAGGAATGTatccagcgccaagaagcgctcTTCAGCAGCCCACCAAGCG
CAAAGCATGCCGAGGCGCATTGTGCCGTCGCGTTCgagcgccgtcgccaacgcgTACCCCGTTGCATGGCTCATCGCAATTTTGTCGGCCCAAGACGCGT
TGCCAAGCGCCTCGCATTTGGCGcgcagctctgcgctggGGAAAGTCGTCGTGGACACACTGCCACTGAAAATTGAAGCCACGCGAGCCTCGATGTCGTG
TGTGGGGGCGCCCATCAGTTTGAGTTCGAGCATGAGCCCATCGCCGAATCGATGTTTCAGGTACTGTACGCTGCCCAGACAGCGTAGACGTCCGCCCACC
ATGATGCCTACGCGTGTGCAGAGCGCTTCGCACTCCTCCATGCTGTGTGTTGTGAGGATGATGGTCGATTCTTTCCGGTGCGTGGAGATAGCTGCGATGA
CATTCCACATGAACCGACGTGACACCGGGTCCATGCCTGTGGAAGgctcgtccaagaagatAATGGGCGGTGACCCGATGAGAGCGATGGCAACGGAGAG
CTTGCGCTTGTTCCCGCCACTTAACGTGCCAGCCAGCTTGTTCTCGAAGTCGTCCAAGTTCATCTGGTGCATGAGTGACTTGACCACGCCTTCCAAGTTC
GCACGAGATACACCCTTGATACG