Description :
From Genome Similarity Track
Location :
scaffold_9:225698- 230410
Transcript NameFunction/comments
g4521.t1hypothetical protein

Sequence
4712 bases(100 bases per row)
ATCACGCAAATGCCTGTAACCGGCTACAGTAGTTTTCGTTGGCTGTAGTCTACTGCATCTACTGTGTTGAAAAAAGTAATTGTCCCCACCTCAGATCGGT
TGGCCGCTACGTAAGTACTTCTCTGGTGATTGTGCAGTTGGCATTCACTGCATCTCCAGACTCTTCAGTCAATAGCCTCCTTCAGTAAGATCGGCTGATA
GTGTTTCTCCAAGCAATTTTCACAGCGTCCAGAGCCATCCTCTTGATCTGTCTGCAAACGTTTCACTGTTGATGTAGATGCGAGCAAGAAACTCTGTAGG
TACAAACTTGTAGGCTAGGTTGGGGTTGCAGCGTCCAGGAAGAGAGACATCGGGAACAGATCGAAATCGAGCAAACAGCAGCTTTACTTCAAGCAAAGGC
GACGCCATTGGCACTTGAATAAAATCACGCAAGGTTGGTGATTCGACTTTAAAATTGAGGTCACCGGTCGTTCATTTGAGATCGAGACCCTGGATAATGC
TCGCAGATCCAAGCCTGAATTTCGGGTGTTTGGTTGTCGAAGATGCCATCTAAGTCTTCCTCAGTGAACTTTGCGTGAAGTTCGTGGTACAAAAACAGCA
ATACTTCGAACTGGTCGGACATTGCGGCAGCATCAATACCTTTAGAGGAAAAAAAACATTCTCTTCGATGCACAGACAACCAGCGAACAACATCAAGAGA
CCTACCACTAGCAGCATTGATCATGCTCGCTGCGTGCACACCTCGACCCGATTCTGATGTACCATTCTACAATCTCCAAAATGCCGTTCTCAGCAGCTCC
GTCCATTGCATCCGGTGTACACCCTCTGACCTGTTCAAATGCAACCATTGCATTACGCCAAAATGCCCGAAATTGGCAACTTGGTCGAATGCTTTGGTCG
TACTACCAGCGCTGGTGTTTTCATGGAGCCACTTTACCAGTTTCAGAGAGTCATGCTCTGCCGCACCATCCATCGCTGCTCCCGTTGCTACTGCCGTGCA
TCCTTCGAAGCGGTGCTCATGAAGCCACCGGGCTATCTGTAACTTACCACGTCTTGCCGCAGCATCCACTGCACTCGTTGTACAGCCTTCCTTTCTGTTG
TAAGGAAATGCCACTTTACAACTTGCAGGTAACCATGCTCAGCTATCAGATGCATTGCTGCCGTCGTGCTTTTTGGACTGGATCCCTTTTCGCAATCATT
TCATTTACCCTTCGTTTAAATCAAAATATGTAGTTGATTCGGATATTTCATCACATCAAGATGTCCACTGCTTGCAGCCGCATCCATCGCGATCGAAATA
TCTCACATGTTCGCTTCACCATAGCCAAACAAGTCAGTATGAAGATCTTCGCCGTAGTCTGCGTACAACCATTGAACCACGTCGAGACGACCCTTCTCGC
TGCATCCGCCATCGTTTTCCCTGGTACTATTCCAGAATTGTCGTAGTAACTGAGGTACATAGACAATTTTTGGAGGCTCCGACGTTGTTTTGCCTGCTCC
ACTGCGCGCTGTAAGCTGTCCGTCGGCTTTTCGTGCGTGCTCGAAGATACTTTGCAACTTCTAATGGCCTGCCACTGCAGCACTATGAATGAAGAGGCTA
ATTTCCCCACCCTAGTCAGTGAGATATGTACCGCCACTCTTTCGTGTATCGCGATTGATCACTCATTGGACAACAACGTCTGTAGCTTGAACACTTGGAT
TCACTGAACTATTGCCACTTTCAAGCAAAGACTTCAGCAACGGGATGGACCCCGTTGCAACTGCTTGACTCACAGTATTTCACGCACCATGCAGCCTTGG
AACCTAGAAGCGAGCCACTTGACCATCTCTAGATTGTGTAGGCGAATAGCTTCCTCCAGCGACAGTGAGAACTGATACTGTCGGTAGTATTTATCCGTGC
GAACAAGTCTCCGTAACGTCCAGGAGAGTTGCGCCATATTCTCGTTGCGAACGGTGAAAATCTCGCTGCTGGCCCAAATCCGACTCAGCAGCTGGATTGA
ATTCCGCTTGCACGCCTCGTTCAGAGGGAGTGAATCCATCGCAGAGTCCAGGGTCGTAGAGACTGCAGCCACAACGTGGGGAAGGTTCAAGAACTCGCCC
TTGGCGCGGAACAGCAGCTTCACGACAATGAGCAGCGCTGGTCTACGAGTTCATCTCGACTTTTTCTGGCAGGATTGATTGTTGGCAAAATATGTGTGTC
GCACACCAATCGAATCCATACATATTTCAAATGCATTCGTAGAGGAAGTAACTTTTGTGCAATTGTTTCATGAAAACGATAGCTCGTACGGCACTATGAT
AGTGACTCATCAACCACTTGGGGATCTCAGACATCCGAAGCTCATCTGTTCCCAGCTCGATCGCGCAGCCTTCGTCTCTTATTTTGTACAATAGCAACAC
GATCTCGAAATGCCTGCAGCGTTTCCTACTGCGCTGGGTGTCCAGCCTTCGGAACGGTTCTCATTGATCAAAGGCAGCTCGATTTCAATCTTAATAATAG
TCGATGGTTGCATTTACTCAATGTTGACTACGCTCAAAGATCCAACCGTTTTAGGGAGAGCAAAGTCGAATTTGAAATTCAAGATGACATTGCTCATCAC
TTGTCGTACAACTTTCGCTGGTCGTGCAGCCATCTGAACTCTTGGCCAGCTTATCAATAATACCAAGACCTGTATTCGGGGTACCGCTCAAGAAGCCATC
TACGAACGCCTGAGTCCGCCACACCTCGCAAGGCGGTGAACTTCCTCGCTTTATCTTGTCCAGTAGTGCCAAGCATTCAAACTCGGACCTTTGAAGTGCC
TGGTCCATGCCTGCTACTGAGTACCATTCGTCGCGATTGTCATACAACCACCGAACAACGCGAAGATGGCCGTTCCCAGCAGCGCCGTCCATCGCTGCTG
TCGTGCAGCCCTCACTGCGGGTATGATGCAGCCACCTTACAACATCAAGTGCCCCGCAAGCAGCGGCGCCGTCCATTGCAGCAGTCGTACAACCTTCAGA
CTTGTTGCAGTGGAGCCACAGTACGACATCAAGATACCCATTGCTAGCTGCTCCATCCATTGCCGCCGCAGTACATCCTTCCGTTCTGTGACCGTGCAAC
CATTTCACTAGATCCAGATGGCCGTTAGTCGCCGCTCCGTCCATTGCCTTCGGAGTGCATCCTTCTCCGCGATGTTGGTGGAGCCACTGCACCACGTTCA
AGTGACCATTTCGTGCAGCATAGTCCATGGCGTCTGTAGTACAGCCCTCCGTCCGGTTATGGTGAAGCCACCGAACGACGTCTAGGTGGCCATGGGCTGC
AGCGAGATCCATTGCTGCCACCGTGCAGGTTGGCGTCCCTGGTGGGGAAGGCCCCAATGGCTGTGCAGAGCTGGAACCTGGATCTCTATGGCAGCACAGT
TCTGGGAACTTGAGCAGCCGTCTGCGTTTCAGGTTGCGGGTGTCTTCGAGGACTGGATCTTGGCCAATTTGATGCAGGAACTGAACAATCGCCAAGTGCC
CAGTAGCAGCAGCTGCGTCAAGTGCACAATCGTACCTCGATTGCTCGTTTGTGCACGCAGACAAGAGATTCATCGTTGGGTCATCACCAAATTCTGCCCA
TAGCCACTGGACAACATCGAGAAAGCCTCGCTCCGCAGCAAGCACCATCGTATCTCTTGAGACTGTTGATAAATTGGTTTCAGATCTAAGTTCCAATTTT
TTCAACACCTTCATCCAGGTGTTCGGACCTCTGCCGCCTTGCACTTTGTCGTCAAAATCAAGTCGAATGTCGATGCGATCGTAGAGGTACTTCGCAACGT
CCAGGTGTCCATTCACTGCAGCAGCGTGAATGGCAAGCCCCGCTTCCCAACCGAGGCGGGTAATTTCAACGCGTCCCTATTTGAATCGGATCTCAGAGCG
AATCCGCAGTCCCCCCAATCACGGTAATTGCGATCTTGTCTATCCAAATCTCGGATAGTCCATCGAACAGCATTCAATTGGCCAGCCTCAGCAGTTTTCA
CGAGCTGCCCAACGTCAATGCCGCCGTAGCCCTGAAATTCCAACAGCTCCAGCATTTCAATGTGCCCGTTCGCTGCTGCTTCACGCATTCCATTACCAGG
CGGCATGTCGAGCCGTTCCCAGAGCCATTGGATCAAATCCACATCTCCACTGGCAATAACAGCCAACGTTGTCTTCTGATCATCTCTCGTGTAGCTTCCA
GCGTATTGATAAAGCCACATAACGACGTCTCTATGACCAGCCACGGCCGCTTTGGTCGCATCCTCGTAGCCCCAGTCGATGCCTCGCTGCTCTCTGTTGT
TTTCATCCTCATCCTCTTCGTCGTCATCATGAGGATTGAGGTTCCTGCCGTTTTGGCCGAAGAACTGCAGGATACTCAGAGCTCCAACTTCTGCCGCCGC
CTCAACTACTTCCCGACCCACACCCCATTCGGGAAAATGTTCAAAGAGCCACTGCACCATCTCGAGATTCCTCTGCTTCACTGCCTCGACTAACGAAGCC
GTGAACTGGAAATCTTGGTAGTGCTTGTCCGAGCGGAGAAAGCTTCGAACAGACCAGAATGGCTCGATTTCGTGCTCCAGGTCGATTGTACTGTTCCAGA
TGCGGTTCAATAGCTTCAGAGAGCCGAACGTGCAGGCTTTATGCAGTGGAAGCTCCACCGATGTGTCCAGGAAGGAAGAAACCTTTTCAGTGATGTGGAA
CAACGATGACAA