Description :
From Genome Similarity Track
Location :
contig_96:22567- 24836
Transcript NameFunction/comments
g10855.t1hypothetical protein PHYSODRAFT_509857

Sequence
2269 bases(100 bases per row)
TGCGTGTGAGCTCTGCTGCAGCCGTCGCAAGAGGCCGCCGAGGTCGTCCTGAGTGCGCGCGTCCATGAAAGGAAACGAACGCGCCCTTTTCGTCCAAGAT
TGCGGAACGATCTGATTTGACGGGGCTGGGTAGAATACATAACATAGGGTGATGTACACTATTTAGCGGCTACCAACAGATCGTCGGCTGAATTTCAACC
AATGTCAACTCGAATGAGATCGCAGTTTTGACCAATAGTGGCACTTCCACGACGTCGTGGATTCCGGCTCGCTGTGTTTCCAGAAGTTCAAAGGCACAAA
ACAAAGCGCAAGCCGGAGGAGCTTCGGTGCGTGCTACTTTCTTCCCCCGTTCGTTCTGCACGTCTGTTTGTGTGTCTAGCCGCTGGTTAACCCCTCGATC
TCTAGTGTCTGCGTGTGTGTGTGAAACAGCGGCGTCCAGATCTTCCCACAAGGAGATTTAACGTCGGATATAGTGGAAAAGGTGCGAAAACGAGAAAAAA
ACACGGCTAAAAGGCGCTCAGAGCGGCGTTTAAACAGCTTTCTAGCAGCTATACAAGCTGCAGCAGCTCGCCCTGCATCATGCAGCGTGGTCGCGTGGCG
CTGTATGACCTAAATGATGACCTCGTCACTGATTTTATGACATTTGTGTCGGTTTTACTCGGTTTTAGCAGTTTCTACAGGGTAAACAAGAACAAGATGG
AGGCTATCGGCCAGAAGCTGCTGGATTTCTCGCAGCCCTTCGATGTGGCGGCGCTGGACCAGGTGGTGCTATGCATGAACGACCCCAAGAGCCCCACCAG
CGGGTGGCCAACCAGATCATGGTGGCGCTGCAGGAACACCAGGACTCGTGGACGCGCGCCTCTGACATCCTGGAGCAGTCCAGTAGCATCCAGACCAAGT
TCTTCGGTCTGCAGGTGCGGTGATAATTGTTGCAGTTGTGACACAATTTGGAGACTCTGACATGCATTTGATGGGCATCAGATCTTGGAGGACGCGATCC
GCTACCGCTGGAAGATCTTGCCCAAGGACCAGCGCGAGGGAATCAAGAGCTACATTGTTGGAAAGCTGCTATCGGTGCGTTGGCGTTGGTTTATTTTTTA
TGGCGATTGATAGAGGTGCTGATTCGGGTGGGGTGTATTGGTTGTGTGCAGCTATCGTCCGATGAGTCGACGCTGCACGGTCAGCGCATGTTTGTGAACA
AGATGGACCTCGTGCTGGTGCAGGTGCTGAAGCACGAGTGGCCGCAGAACTGGCCGTCGTTCATCACGGACATCGTCAACTCGAGCAAAACGTCGGAGAT
CTTGTGCGAAAACAATATGACGATTCTGAAGCTGCTGAGTGAGGAGGTGTTCGACTTCTCGAAGGACCAGCTGACGGAACAGAAGACCAAGTCGCTCAAG
GAAAGCCTCAACCACGAATTCACGCAGATCTTTCAGGTACGATTGAACGCACGGAGAAAGCGCGGTTCGTGTGGCCACAATCGTCTTCGATCTCAACAAC
GCTAACGTTATGTTTTTATTCTTGCTGTCGATCCTGCTACCGTAGCTGTGCGAATTTGTGCTGAACAAGTCGACACACGTTCCGCTGCTTCAGATTACGC
TGCAGACACTGCTTCGTTTCCTGAGTTGGATCCCGCTCGGTTTCATCTTTGAGACGGACCTCATCAAAATCCTTGTCACAAAATTCCTGGCGACGGGCGT
GTTCCGCAACGAAACCATCAGCTGCTTGAGTGAGATCGCGCAGCTGCGCGACGTCCCTGAGCAGTACAACAACGTGTACGTACAGCTGTACATGGGCGTG
CTTAACGAGGTTGGAAAGATCCTGCCGCCTGGAAACTCGTTCACTCCGTTCTGGGAGCAGGACGAGGTGTTTGTTCAGCGTTTGAGTATTTTCTTCACGA
GTTTCTTCCGTTACCACATCCAAGTTATTGAGCGCCCGATTGCCGCTCCGGGTGATGAAGCCCACCAGGCGCTGCTGGCGGGATTCACGTACCTTGTGTG
CATTGCCGAGGTGGACGACGACAGCATTTTCAAGATCTGCTTGGACTACTGGCATTTCTTTACGCGTGATCTGTACACGGTGGACCAGAACCAAATGAAC
CCGCTTGCAGGATTCCAGAACCAAGCTCGTAGTCGCCGTGAGCTTGTATCGCCCGTGATGAACCGCGTGCGTCACGTAATGATCTCCAAGATGGTAAAGC
CGTCAGAAGTGCTGATTGTGGAGGATGAGAATGGCGAGATCGTACGCGAGACGACCAAGGACACGGAGG