Description :
From Genome Similarity Track
Location :
contig_9:225659- 230361
Transcript NameFunction/comments
g2618.t1hypothetical protein

Sequence
4702 bases(100 bases per row)
GGGGGGGGGGTCAGTTTGCAATTCACATCTCCGTCCACAAACCGATTATACCGACACCCTCGCCATCAAGTTCAATGCGTGTATCTCAAGTGCTGTTAGC
AGCTACTGCCACACTCTTCGCACTAGTGCCGATGTCGCCACCGCCAGTGACGCTGCCGTAGCTGCAAAGACCAAGTCTTCAGCAGCTACAAACGAATCCC
TGAGCTTTTCGTGAAGAAGATTCCGTTCAAGTATGGCAACGTTACTGGCACGATGGTGATCACGATCGACCCGGACAGTCTGCGCGAGGTTGACGATGAC
TCTGCCTCCACCGACGCATCAAAGGTGTACGACTTCACCCAGTCTGACGAATCTGGATCGGAGGGTGAAGAGAGAGCGCTGTTTGGGAGCAAATTTATGG
AGTCGCTTGTGCTAGGATTTAACGGTTGGCGCAATACGTGGACTAGGTTCAAACTGGGGTAAAGTGATTCGTACTACTACTAGTATCACGCAAATGCCTG
TAACCGCCTACAGTAGTTTTCGTTGGCTGTAGTCTACTGCATCTACTGTGTTGAAAAAAGTAATTGTCCCCACCTCAGATCGGTTGGCCGCTACGTAAGT
GCTTCTCTAGTAATTGTACAGTTGGCATTCACTGCATCTCCAGCCTCCTCAGTCAATAGCCTCCTACAGTAAGATCAGTGGATAGTGTTTCTCCAAGCAA
TTTTCACAGCGTCCAGAGCATCCTCTTGATCTGTCTGCAAACGTTTCACTGTTGCTGTAGATGCGATCAAGCTACTCTATAGATACAAACTCGTCGGCTT
GGTTGGGGTTGTAGCGTCCAGGAAGAGAGAAATCGAGAACAGACCGAAATCGAGCAAACAGCAGCTTTACTACAAGCAAAGGCGACGCCATTGGCACTTG
AATAAAATCACGCAAGGTTGGTGATTCGACTTAAAAATTGAGGTCACCCGTCGTTCATTTGAGATCGAGACCCTGGATAATGCTCGCAGATTCAAGCCTG
AATTTCGGGTGTTTGATTGTCGAAGATGTCATCTAAGTCTTCCTCAGTGAACTTTGCGTGAAGTTCGTGGTACATAAACAGCAATACTTCGAACTGGTCG
GACATTGCGGCAGCATCAATACCTTTAGAGGGAAAAAAAACATTCTCTTCGGTGCACAGACAACCAGCGAACAACATCAAGAGACCTACCACTAGCAGCA
TTGATCATGCTCGCTGCGTGCACCCTCGACCCGATTATTATGTACCATTCTACAATCTCCAAAATGCCGTTCTCAGCAGCTCCGTCCATTGCATCCGGTG
TACACCCCTCTGACCTGTTCAAATGCAACCATTGCATTACGCCAAAATGCCCGAAATCGGCTGCTTGGTCGAATGCTTTGGTCGTACTACCAGCGCTGGT
GTTTTCATGGAGTCACTTTACCAGTTTCAGAGAGTCATGCTCTGCCGCACCATCCATCGCTGCTCCCGTTGCTACTGCCGTGCATCCTTCGAAGCGGTGC
TCATGAAGCCACCGGGCTATCTGTAACTTACCACGTCTTGTCGCAGCATCCACTGGACTCGTTGTACAGCCTTCCGTTCTGTTGTAAGGAAATGCCACTT
TACAACTTCCAGGTAACCATGCTCAGCTATCAGATGCATTGCTGCCATCGTGCATTTTGGACTGGATCGCTTTTCGCGATCGTTTCATTTACCCTTCGTT
TAAATCAAAATATGTAGTTGATTCAGATATTTCATCACATCAAGATGTCCACTGCTTGCAGCCGCATCCATCGCGATCGAAATATCTCACATGTTCGCTT
CACCATAGCCAAACAAGTCAGTATGAAGATCTTCGCCGTATTCTTCGTACAACCATTGGACCACGTCGAGATGACTCTTCTTCGCTGCATCCGCCATCGT
CTTCCCTGGTACTATTCCAGAATTGTCGTAGTAACTGAGGTACATAGACAATTTTGGAGGTTCCGACGTTGTTTTGCCTGCTCCACTGCGCGCTGTAAGC
TGTCCGTCGGCTTTTTCGTGCGTGCTCGAAGATACTTTGCAACTTCTAATGGCCTGCCACTGCAGCATTATGAATGAAGAGGCTAATTTCCCCACCCTAG
TCAGTGAGATGTGTACCGCCACTCTTTCGTGTATCGCGATTGATCACTCATTGGACAACATCGAGTTCTCCTTTATCTGCAGCTATCACCACCAGTCCAA
TAAGCCCCTCCGCTTGACCTTGCTTGAGCAGCCATTTGAGCACATCGATGCGTCCTTGAGCTGCCGCAGAGTGCGCCAATTGCAGACCTTGTGCATTTCT
CGGCCATCTTGCACCTTGCTGGAGTAACCAATCAGACAATGGCACGGCACCATTATTCACTGCAATCCGCAGAGATCTGTCTTTGTCGTGACTTTCATCT
GAAAAGTGCTCAAACAACCACCACACGACGTCACTACGCCGATTTGACACTGCGTCAGAGAGATTTTTCTCGCTCCATTGGACACGAATACCCACGTCTG
TAGCTTGAACACTTGGATTCACTGAACTATTGTCACTTACAAGCAAAAACTTCAGCAACGGGATGGACCCCGTTGCAACTGCTTGACTCACAATATTTCA
CGCACCATGCAGCCTTGGAACCTAGAAGCGAGCCACTTGACCATCTCCAGATTTTGTAGGCGAATAGCTTCCCCAGTGACAGTGAGAACTGATACTGTCG
GTAGTATTTATCCGTGCGAACAAGTCTCCGTAACGTCCAGGAGAGTTGCGTCATATTCTCGTTGCGAACGGTGAAAATCTCGCTGCTGGCCCAAATCCGA
TTCAACAGCTGGATTGAATTCCGCTTGCGCGCCTCGTTCAGAGGAAGTGAATCCACCGCAGAGTCCAGGAACGTAGAGACTGCAGCCACAACGTGGGGAA
GGTTCAAGAACTCGCCCTTGGCGTGGAACAGCAGCTTCACGACAATGAGCAGCTGGTCTACGAGTTCATCTCGACTTTTTCTGGCAGGATTGATTGTTGG
CAACATGTGTGTGTCGCACACCAATCGAATCCATACATATTTCAAATGCATTCGTAGAGGAAGTAACTTTGTGCAATTGTTTCATGAAAACGATAGCTCG
TACGGCACTAGGATGGTGACTCATCAACCACTTGGGATCTCAGATATCTGAAGCTCATCTGTTCCCAGCTCGATCGCGCAGCCTTCGCCTCTTATTTTGT
GCAATAGCAACAGGATTTTGAAATGCCTGCAACATTTCCTACTGCTGGGTGTCCAGCCTTCGGAACGGTTCACATTGATCAAAGGCAGCTCGATTTCAAT
CTTAATAATAGTCGATGGTTGCATTTGCTCAGTGTTGACTACGCTCAAAGATCCAACCGTTTTAGGGGGAGCAGAGTCGAATTTGAAATTCAAGATGACA
TTGTTCATCACTTGTCGTACAACTTTCGCTGGTCGTGCAGCCATCTGAACTCTTGGCCAGCTTATCAATAATACCAAGACCTGTATTCGGGGTACCGCTC
AAGAAGCCATCTACGAACGCCTGAGTCCCCCACACCTCGCAAAGCGGTGAACTTCCTCGCTTTATCTTGTCCAGTAGTGCCAAGCATTCAAACTCGGACC
TTTGAAGTGCCTGGTCCATCCTGCTACTGAGTACCATTCGTCGCGATGATCATACAACCACCGAACAACGCGAAGATGGCCATTCCCAGCAGCGCCGTCC
ATCGCTGCTGTCGTGCAGCCCTCACTGCGGGTATGATGCAGCCACCTTACAACATCAAGTGCCCCGCAAGCAGCGGCGCCGTCCATTGCAGCAGTCGTAC
AACCTTCAGACTTGTTGCAGTGGAGCCACTGTACGACATCAAGATGCCCATTGCTAGCTGCTCCATCCATTGCCGCCGCAGTACATCCTTCCGTTCTGTG
ACCGTGCAAACATTTCACTAGATCCAGATGGCCGTTAGTCGCCGCTCCGTCCATTGCCTTCGGAGTGCATCCTTCTCCGCGATGTTGGTGGAGCCACTGC
ACCACGTTCAAGTGACCATTTCGTGCAGCATAGTCCACGGCGTCTGTAGTACAGCCCTCCGTCCGGTTATGGTGAAGCCACCGAACGACGTCTAGGTGGC
CATGGGCTGCAGCGAGATCCATTGCTGCCACCGTGCAGGTTGGCGTCCCTGGTGGGGAAGGCCCCAATGGCTGTGCAGAGCTGGAACCTGGATCTCATGG
CAGCACAGTTCTGGGAACTTGAGCAGCCGTCTGCGTTTCAGGTTGCGGGTGTCTTCGAGGACTGGATCTTGGCCAATTTGATGCAGGAACTGAACAATCG
CCAAGTGCCCAGTAGCAGCAGCTGCGTCAAGTGCACAATCGTACCTCGATTGCTCGTTTGTGCACGCAGACAAGAGATTCATCGTTGGGTCATCACCAAA
TTCTGCCCATAGCCACTGGACAACATCGAGAAACCTCGCTCCGCAGCAAGCACCATCGTATCTCTTGAGACTGTTGATAAATTGGTTTCAGATCTAACTT
CCAATTTTTTCAACACCTTCATCCAGGTGTTCGGACCTCTGCCGCCTTGCACTTTGTCGTCAAAATCAAGTCGAATGTCGATGCGATTGTAGAGGTACTT
TGCAACGTCCAGGTGTCCATTCACTGCAGCAGCGTGAATGGCAAGCCCCGCTTCCCAACCGAGGCGAGTAATTTCAACGCGTCCACTATTTGAATCGGAT
CT