Description :
From Genome Similarity Track
Location :
Scaffold_33:225650- 233349
Transcript NameFunction/comments
Phyci_161248Hypothetical protein
Phyci_222024Hypothetical protein
Phyci_273768Hypothetical protein

Sequence
7699 bases(100 bases per row)
tccatgtgtaaaatgatccctctctgcggtacaaacgtttttggccagtgtacaatGGGTGACTTCCAAATATGAAACATGAGGTGTAGACAAGATCGAA
TTTGTGCGTGGGTTGGTCCACAGTTTGTGACGAGTTTGTGGCATGCTTGTGCGTGTTCTGCCCTCCAAAAACATAGCAAACCTGCGGAAGAGAACACAAT
GATTAGATCAGGCAAAACACTTCATTACAGAATTTCCAGTCAACCACGAGCAACCACGAGTATATTTTAACATGGTCCGCTACGCCCACGCCCTCGCCAT
ATTCCAAGCAGCACAAAGACACCAAGAGCGCCACCGAAACCAGAATCGGGCAAAGAAGTTACTAGCGCTCATGCGTATTCGTATCACATTGAGAGAGCGG
AATTACCTGATTGCAAATGTGCTGATTTCTCCGTCGGAGAGTCTTTGGTCTGTGATGTACGAAGCGCAAGATGACAGCGCATTCCTAGTGGCAGTTTCAT
TACCTGTGAAGGAGTTCAACTTGTTGTTGGCAGCATTTTCGCGGCATTACATTGTCAAGAGCGGACCAGGTAAACGGGGACGACCTGCTCAACTTATCAG
CAAAAACAATGTGCTTGCGTGTGTCTTACATTTTTACATGGCAGCAGCGGAGGCTAAAACATTGTGCAAATTGTTTAGAGTACCGCCAGCGACATTATCA
CGGGTACTCAAGCATGCTGAAGCAGCCTTAGCCAAGGCGCTTCGGGATCTCCCTGCAGCTCGAATTTGCTGGCCGTCCTTCGCGGAACAGCAGCAATGGG
CTGCAAGTGTTGCGTTGAAGGAGCCTCTCATTCGAGGTTGCTTTTGCTTTGCCGACGGTAAAAACTACGCGGTTCATGCTCCAACATCCAGCGACTTGCA
GAACGCGTATAAGAATTCTTGATGTTGTTGTTGCTAGTGCTGTTGTTGTTTCTAGCACTTACGATTTTTTTTCAGGATGGTTGCTTGCAGTGAAGGTAAC
AGGCGTATTATGCTACGGGTTTGATGGAACTTTGATCTGGGGTTGCCACAATTTCCCGGGGTCTTGGAATGACGGCGAAATGAGTCGTCGCCTGCAATCC
CGTCTTGCCGATCGTACTAAAAACGCTTGAATACGGTTGTTGTGCAACCGATTCTGCCTTTCCTGTAAGCAACGCGCTTaccgggaaaatcatcacgccg
ctgaaagatggcgatctagaaaacacgagtcaagcttgcagactcgggcttattgcaatgagtaattcgataacggcaattcgacaagctgcagagtgag
ggatgggctgtgcctcgaaggtgtacaggcaattgcttttgccccttcctttcaaccccgaATGACGTGGATTACGACTGGAGAACATCTATCTCTTGTA
CAATATCCGAGTGCGAACGACATGTATTAGTCAGATTAAAAGCGTCTATATGCAACAGAAGAGATCGATCAGCCAGATAGTTCCTCCCATTTGACAACGC
TCGATTTTCATATTAGTGCAACATGCTTGAAATGTAAGAGAACAGAACTCGATTAGCGGTGTGAAAATGCAAAAAAAGAAGCGCCTTAGAGACGCTGCTA
CGCGATCTGCGATCTACTCATTTGATGCACTTGGTGGAGGTACACCAAAGATCTTGGCCATCAGCAACATCACCAGCTGTTGGCTTTGAGCTTCGCGGGC
ACCTTGACTTCGGGCCAGTTCCAGTTGAAACTGGCGTTCGCGAGCCTCGCGCACCGCTTCCCGCTCTTCGCGTTCACGGCGAACCTCAGCATCTCGAGCA
GCTTGACGCTCCTCCATCATCATAATTACCCCGAGCAAATTTGATCCACCCCGGCGTTTCCGGGCAAAGTATCTGAAGCCACCTTATCCATCATTTTGTC
AAGGCGAATACGCCGTTGGGCTGTTTGGCTCAGCAAGGTGGTTGAAGTGATACCCGAGTCACTCACTCTTGATATCCTGGTAGAAAGTTGCGCCAACTGT
GTCGGCGTTAGGCCGGCCCTAGCAATTGCGGAAAGAGCCGCGGTCGTGGACGTTGTGACCCGGCTAGAGGTGGGCTGCGGTGGTGACGGTGTACTGGGTC
CCTCCGCCACAGTAACCCGCAGGGGAGTTGGTGCATCTTCATCATGCACACTATCGGTCGCTGGAGCGCCACCAGCGCCGTCCGACTCGCTCGAAAAGGC
TTCAAGTCCGTGGTCAGCGTCGCCAAAACCGTCACTATATGGCCCCCCTTCTGGTTCTAGATCTGCTTCTTCTTAATCGTCGTCGTTCAGTGAGCTAACT
GCACAGCGGGCCTCGATTCTCTTGAAGGCTATCTTTGCACGCTTAATCTCCGAAGGGCAGTCTAGGTCCTCTGTAGGCTTTCGCTTGTTCTTCAAGGGCA
TGAACTTGCGCCTAAGGCTGTCTCCATCCCGCTCAGGCCATCCAGAAGGTAGATGAGCGTTGTACGAGGAGGCAATGTTCGCCCATTGCTCAGATCCGAA
AGGGAAACTTGATTCGACTAGGGGTAGCATACCTATTGAGGAACGTTAGATTTCTACATACAAAGCCAGTATGATCAAAATGAACGTACGATCTAATTCG
GCGGCACGGAAGTTCTTCCCTTTTGTCTTTTTCCCGGTGTTGGCCATGACTAATGAGAGTGTTGAGCGTATTGTTGAAGTTGTTGGTGGGACGCCGGCTG
AAAAGTGGGATCTGCACAGAATACTACATGACAGGGGCCATCGTCCTCAAGTGTTGAGCGGCAGAGGGGGCAAAATGTAAAATACGCACCCACAGTCCTA
AGAACTGGCGATAGGTGTTAATTTAGCATTTGTGTTAGCATAAGTTTGCTCAGACGTGAAAGTCGTCTCACCATCGTTTGTGTCACCTTTGTGCGACGTA
TGTGTCATCACTTGCGCCTCGTATGTTCCAAGACACATGTGAGGCTTGAGTGATTTTTGGAAGTCACCCAATACCTGAAGCCTGCATCCAAACGTGGTTC
TTTTCCTGGAGGAGTatatcacgcacattgagtctctaccgtactaatcgatcttgatgtggctcctgctctaggcgctctaccactttcaagtgcattt
ttcgcctgtcctcgttcgttatcacaaccacggcgacgcaCATGAGCGTGCGAGAAAACTTCCTTTTATTAGTAGTTTTTACTGACGCTGAATAATATAG
GGATCCGTAAAAGTGGCATCCCCAACACATTGTATTGTAATCAACCAATCAACCAGGGGTTGGTAGTAGTGGGAATTTTGGCTAGTAgtgtagtgggtct
aacttgactcactacttttgctttcacgttgcgctacgtgtatgaggaagcgtaagtacttagtaattacttgagttaattatatttgaatacacaaata
taatttaaatcagatgagactccaagtgacttagattaggtaaaatgagaactgtattgtttgtaaattgatcttccttctaaaactgctaaattgttta
tcatctatgaaaggggttgatagcggctggTaagtatgggtacaatagtagtgataatatcactactatttacaatttttggctaatactcaatcggcac
tattactgaccttaattccagttttgtagcagcaatagcaatagtagtaataatatacctactaactttataatactataagactactaccaatccctgT
AATCAACTCTTCTATTTTTGAACTTAAAAGTGATCATAATCGGGGTTTGGTAGCACTGATTAGATTAATAATTGTAGTAGTAATATTGTCACTACTATCC
GCACGAGTACAGCTATAGTTATGGTCTTAGAGCTATTATGCATTTAATACTACTATACTTTTAATGGGTCGTATTAGTATAGCTGCAGTAGTACTATAGT
AGTATTTATAATTTCGAGGGTACTTAAATGCTAATAGTATTACTTGAACATATCTCCAAAAGTATGAtagtattaggagtgttcctgctacccgaaatta
cgactactaccaaaccctgaATATAATACTCCAGGAGCCAGTCTTTGTTTACTGTTTCAAAATTGTAGCATTTTTCTATTTTGTACTTGAAATAGCAGCT
TAGATTCAAATACAGTAGCCTAGCCATAAGATACGTTTCACTTTGATACCGTGTAATGTCACTACGATTGATAGCGGTCTTTTCTTTCATAAATCACGTG
TAGAATTTGACTGCTAGGGTGTGCTGTCCGCTTGGACATTCCAAAAACGTTGCATGAAGTTACCAATGCCCGGTCGGATGCGTTTATTCACGTCTACGAC
GGTGTCTACTTGCGCAGTGATGAGAGATACACCTGTGCGAGTGCACAGGAGATGTTAGTTCGCGAAGCACACTGGAAGCTGAGTCCACTGACTCACCTGG
AAAGTGCCGGAACACTTTCTGAAGACCCTCGAAGGAGCTAATGATTGTGACGAGATAGATACGTTTAGCATCTATCTGCCTCTCGCGGACGAGATGACGT
AGCACCGCGCATACTTCTTCACCTGTAGCGCACTCAATGTCAAGGAGCAACACGGCTTGGCGAGGGGTTATAGGCGGCAGCTGTGTGTGTACGATGGACG
GCGAGGCATCTGTAGTCCTTGTGTCAACAGTCATCACACCCGTGGGTGATGTCGGACTGATCGTGGAGAAGGCTCGAAGCAGTACCATACCCTTGTCCTC
CATAGAGATACCGCAGATACCATGTTCCTCCAATGACTTGGCTCCATGACAAACGTCTCCGAATTGGTTTGTTATTTCGACGTCCTCATGAGGCAAACAG
GTAAGCGCCTCTTCGATCAGAAGTCGCGCCAAACGCGTTGCTCGCTGCTGGAATACGACCGTGCTGATACTTTCGTCTCGCAGTGCAGCAACCAGGTTCC
TGCAAGGGTACGAATATGCCGAAGCCTCGTGGACAAGAAATGGTCTGGACACTACAACATCGCCTACGATGCCCTCCAAATGCGATCGCTGATCACGTGG
CAGTTCGTCTGCTTCACCCTGGAAGTGGTTCTTGTGTTGCAGCTGATGGTGCATGAACTGATCGGGAGCCACAACGGATAAGTGGTTACCACCTTCGTTT
TCATCGTTTTCGGACTGAAGCTGGAAACCTGTCGAGTCCTCCTGATCGTCACGCGGGCTCTCCTCCGAACGAATCGATATTGTCGACACATCGGGGCACA
CTGGTGCCGGCTCTGGCGCAGCAATGCTCAGTTCTGTGGCTGAAGTCGAGGTCTGCTGTGGACTCACCTTCCTGCCACGCGTCTTTTTCGGGTGTTTGGA
CTCGGGGTTACGACTCCCCCGAGTTAGGACTTCCCACCGATTCTTGTAGAGGTTGCAGATGGCGGCGCGGCTAACGCAGAATTCTCTCGCTAGCGTCACC
TGCTTCTCGCCGGCATCGATACGCGTGATGATCTCTCGGCGGTCTCCCTCGCTCAAGTACCTTGACGTGCGTTCGCGACGGGGTGCCGCCACGGCCGGTT
GTGACGCGAAATAACGGGTTGTCTTCACGTCCGAGATATCGCTGCCTTGAGGGGACGATGCAGATGAATACGAGAGGCCATCCGACGTGATGAGCGGGCT
GGTTTGACCTTCCGTGGCATAAAGGCTGCTCAGCCTCGAGAACACCGCCGCATTCGGTCTCTCGGTGTCGTCGTGCACGGAAATCGCGGGCGACGACTGC
TTCCGCTTGAGCAGCTCGCTCTCGGAGTGGTGGGAGGAGTGTAGTCTAGGACTAACCGCCGAGAACGTGCCTTCGATGCTGTTACGTCGCTTCTTGAGCT
TGAGGCCGCTGGTAATGCCGGTGATGGCCACGCTCGAGGTACGCGTGTCGGAAGACGGAGCCGGCAGGTACGAAGAGAGCTGCGGGAGTACCGGCGGAGA
CGACCCGGTAGGATCGCGCCTCATGGTGCACACCGTCGACGTACTACAAAATCGTTGGTGCGCGAGAAGTCGGGAGTGACTGAGGTGAGCGAGACCCTCA
CTGTTTTCGTGTGAGCAGTCCGGTTCCGTTTTGGCTTCTCTGTTCATACGCGTCGCGTGCCGAGTTGACTGAGGGCGTCATGAGAAGGTACTACGGAAGG
CAAGCGCTGTTGCGTGTGCGAGCGTCTCATCTCGGTCGCCCGCACAGGCATCATATCCGTTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGG
ACTTGACAAGCTTGACAAGCGGTGTGTCCAAGCGGTGTGTCCAAGCGGCAGGTCTAGCGTCCCAACCCAGCCGCGTTTGAAGTGCAACATGCGCATGAGC
TGGATGTCCTCGGTGAACCTTCTCCTTGCAGTGGCGCCTGGTGCTGTTGCAAGAAGGCCGCACACCGGGGCTGTATGGCCTCTTCCACAGCTTTCCAGCT
AAGTCAGGAGACCTGCTGCAACCACACCCCAACGACCGTCAGGTCCAGCGAGCTGGTCTTGTTCATAAGCCATGCAGGCGCGAACCATGGATCTGCAGCC
TGCAGCTTCTCATCGGCCAACCACGGCCCAGGACGGCGACGAGGTTATGAATGAGGCACGCTCGAGGCGTATTCGCTTCATTCAGGTGCAACCTACCGAT
AAACTACAATGTCCGGAACAACGTATCTACAGATAAGGGATATGTCATTGGCAAAAAgtataagtcttgccacgaattggcaccgtgccaggtttggcat
tttaccttATCAATAAATCGACAATAAGTGTTATACTTATTATATGTATTATACTAAGTATATTATATAATATATTCCTGTTCGATATGGGTTCTCACGC
AAAAGAACGGTCAAGTTGGTGACAAAAAGTGAAAATGACGACTGCTTTACACTGCAACGCTATCTTTTCCTCGGTCTACACCTGCGTTTTTCTAGCTGCA
ATCATGCACGAGCTGGAATCGTTGAATGCTTACTGTAGCCTTTGAGGATTTTGGGCCACCTTGGTGTGTACAGTGGCTTACGCTGTGGAATCAAGTTAGC
ACACAAGTTCAATGCATCACAACATCCGAAACTTTCGGACCGAAAGCAGGCTTTTCGCGGATGATGATGCTCGGTTGCGGGTTCGCGTAGTCGTGTACTA
CGTGATAGTTGGTGATGTCAGCGCCGTTCATGATTACAACCCACTTACGGGGAATTGTTTGCCAAACATCTTCAACACAAGTATTTTTTGTAGTACCGT