Description :
From Genome Similarity Track
Location :
Scaffold_501:2256- 6928
Transcript NameFunction/comments
Hyaar_Emoy2814235reverse transcriptase

Sequence
4672 bases(100 bases per row)
CGTAAAACGAATCCTGGATTGGCCTCTTTGCGCGAGCGAGAAGGCAGAGACGATCTCGTGCTGGCCCCCGTTGGAAGCGGATACTGCAGCTGATTCTTCA
AGATATGATCGACGGCCTTTGCGATTTGGACATTTTACTGGACCCCATGTTTCTACACTTTCTCCGTCCGAATGAAGCTAGGGTGTGGTATCCCGGCCTA
TCCGTGCGGTGGACCAACATACCCAACTTGATCACTGCTTTGTCGATCAATCACGCTTCCGAGCGTTGGAGGAACCAGTTTCGTCGTTCGATCGCATCCG
ACCCTGGATCGTCTCTTCCAAGCTTGGGTGGTAAGTTCTTTGACCGCGAGTGATTTACTTGGTCTGTTCCATGATGCGATCTCTCAATCTACTTTCTTCT
CATTTCCATTTGGTCGCTCCCATCATTCGTATTTCTTTCATCTTTTTTTGTCTTTTCATCTTGATCGCAGCATTAAGTCTGCGATCGTCGCACTCAATTC
ACATAAATCCCATTCCATCTCCATGTGCAACTTCCTTGCACCCATAACTCTTCTCCCCGTCCATGCACCGTCCTTGCATAGACCCGTCCACTCAAACTCT
CCGATCATCGCTATTCTCTGGCTCTTCCTCGTGCGATTGCATCACATCAAAACGATTCTTGCTCACCTGATCGCAATCGAACTCTTACAGCATAGCTCGA
AAATTTAGATCAGCTTCGTCAATTGGGTCACTGTACTCCTTCCATTGTACCAGGTACTGCTTGTGTATTCGGCCATATCTCGTCTTCCGTCCTGATCGCA
CATCGATGATCTTGTCTACTTCAACTCTTCCGCGTCGAGATTACCCTCCCAACTATCTTCCGGCAGCAGTGCTTTATCAAAATCAAACCGAATTGCCTCA
TCCGCATTTAATCCACCCGTTGGGCGTTCTGGGAATATGCGAACTAGCTTCAGCTTAGACACGTGGAATATTGGGAATAGCCGGTACGGCGTGCCGGCGA
TGTCCAACTTTACGGCGTGATCGCCACACTTCTCGGCCACTCGAAAAGGCCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTC
TAGATATAGCCAAACTCGCGACCCGCGATCGGTATCCAATAAATATCGATCTTCATTATGTCGATCGGCTCGACCTCTGATCGCAACCTTCAGTCGTTCA
TTCACTACCGCCCGAGCACGTTGATATTGGCGTTGCATACCATATCTCCATTTTCGGGCATCTCGATCCCGGGGTTTGGTACTTCCCAACGGTAAGGTTG
CTTCCAAAGTCGATCTTGGGTCCTAATCGTGAATCAGGTAGAACGGTGTATGTCCTCGAATTCTATCATGAGCGGTTTTGATCGCATAAGTCAATCGCGC
TGCGTATTCGTCCCAGTCCTTTTGATTTTCATCCATGACATACATCTTGATCGATCGAGTCAGCGTCTGTACCATGCGTTCAGCCGTACCATTAGCTTGC
GGTCTATACGCCATAGTGGCCCGTTATTTTTGTCCCGCGATCCGATTGAATGCTCGGAAGAAATCAGACATAAATCCCGGCTCGCGATCATGTCGTATCG
CCTCACTCGCAACGAATCGTCTGAACACGCACTCCTCGTAATTCTCTGCGATCGACTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCTGA
GAAAAAATCTACCCACAGCAACAGTTCGGTGTTTCCTTTAAAGGATCTTGGCAACGAAGGGATGTTATCCATAGCTATAATCTGAAAAGGGTACGTCGAT
TGCATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCCCGTTTCACAATCTACACATTCTCCCACATGCTGCTGCACACTTCGGTACAACC
CACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTACGGCATATTCCTTGGTGACCACCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAGTCTCGCTG
TAACTGTTCTGGAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGAATAGCAGCCCACTTTGGTCTAATTTA
TAGTCCGGTGCGATCAGGGTGCACACCTTATCCTCAGCTGCCGAAAATTTAGCTACGTCTCCAACCAGATATATCTTCAAACTAGATATCCAGTTTTCTT
CGTCTTGTGCTTGCTTAATACGACCAATCCGTATCTGCTGCACAACCTCTTCCTTTAAACCCTGGGCTGACAACGTCTTCTCTGGGCTGTTCGAGTGATA
GCCGCTAGTTTGATCGCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCGATTGAGAGTAATCAGGTCCTGACGCTCTTGATAGGAAACCACAA
CTGTCCCTTTTTCTTGCCGCAGAGCTTCACTCTCCAATCGATCTGCACTCTGATTCTAGTCCCGCTTCATGTGCAAGAACTCGTGGGATGGCCACGATCG
TAATCTCTCCATAGCCCTATGCCTCAGCAACTGCAGTCCCGGCGATTTACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATTCGAATCTCCGCAG
ATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCGAAACTAAGGAGCAGCCCTCGGTATTCTGATTCATTCATGGTTAGATCAGGGGTATACTCGG
AAGCAACAGCCACAATCGTCCATTTCGGCACTTTTCCATGTACTCGCGCTGTATGCTCCGTCCTTTCTTTTCACCCTGGCTGATCCATCGAAACTGGCTA
CCAGCATGTTTTCATTCACACCTACTGTGGGTGGTGACATGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGCGATCGCAATCAATACTTCATCTACTTC
TTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTTCTCCCTTCTCAAATCGCCTAATTTCCAACGTCCAGTTCGATAGTAAAGCAGCT
CATCTTCCCAATCTTTCGTTGTGGCTTGAAGATTGTAGTAACCATGCTAGTGTCTAATATCGCGTAAGCACCGTAATCTCACGGGATACTAGCATAGTAT
AGCAGATGTCTAGCATCCGGAGGAGAGCCAACACTTCTTTCTCCACCGCCCCGTAGTTGACTTCGTTGGGCCTTAGCATACGACTAGAGAAAGTGACAGG
CCAATACACACTATCATATTCTTGAAGCAGAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATTACAGGCGATCGATCGGGATCGAAATGCTTT
AAGATTGGAGTTGTGGCTATCTTAGTCTTTAGCAACGTGAATGCAATCATTGCCTTCTCCCATCGATTCCTGCCCTCCGGATCGCGATCGTCCCCTGCAA
TTGGGTATAGATCGACATTGATCTCCGGTTTTGGGTACAGATCACGATCGCCCCCTGCACTCCTTTCGTGAATAGCATCCGGTCTTACAGCAGAGGTCGG
TTTTGGAGCTTCACTCACGCGGTTGATCTCATGGAAATCTGCTTCACGCAGTTTGTACAACACTGATGCGTAAACTGCGAAGTCTTCAATGAATCTACTG
TAATAGTTGAGACTTCCCAAAAATGACTGCATCGCTGGCAGCGTCCGAGGGAACGGGATGTTCACCAACGATCCCAGATCGTTCCGGTTAGCTTCCAAAC
TAGCGAGCGATATTTGATGTCCCAGATATTCAACCCTGCAACGTCCTCAAAAACGTTTGGCCAAACTGATCGACAAATTCCACTTATCGCACACCTCCAA
TAATCTCTCCGCTTTCTCATACAGGGCCTTCCACAACGTAGCTGGTATTAAAATGTCATCAATACAAGATCTTCGACCCAACACTGATGGTTTTGGATCA
GTATCTGGTTCACCATCAGTGAAGACATTGATCAACTTCGGCGATTCCGCCGTGGTCGATTCGGATTTTACGCCGATTTTCAAATACCCATACAGAGCGT
TATCGATCAAACGTTGGTAGATCTGTGGAGCATTTTTCAACCCGAAAGGCATCCGCAACCACTCTAACAACCCTGATGGTGTGATAAAGGCGGAAATCGC
CCTTGCTCTTTCCGTCAACTCCACCACCCAAAAACCACTCGCCATGTCCAGAGAGCAGTACCACATAGCTTTATCCATGTCTTGCAATAGTTCGCTGATC
AGTGACATCGGATACACCATCAACCTAGTCAGCTGGTCACCCGCCCGTATTCAATACACAGCCTTATGTCTTCTCCGTTTTTCTTGATGATCACCACTAT
GGGGGACACCCATGGTGATGTAGACGGTCGAATGATCTTGTCCGACAGTAATCCCTTGATCAGATCGGCGAGTTTTTCTCGGAACTTTGGTGCTACAGGT
CGGACCCGTTGTGCGATCGGGTTAGCTCCTCCCACGTCGACGTCACAAACTGCCCCACGCGCCGCAGGAGGTAGGGCGTTACCCTTTCCAATAAGTAGAT
GCCGGCTCTTCCAAATCGTTTGGCGCAACTTCTCTTGATCCTCGGTTCTTGGGGTGCCGGGATCGCCTACTTGAATATCATCAATCATTATTTCTTGTGT
GGGCGTACCCACTTCGGGAAGAACTACCATGTGCTGATCCACATCTTCCGCGAACAACTCGCCACCATCATG