Description :
From Genome Similarity Track
Location :
Scaffold_1702:2256- 3743
Sequence
1487 bases(100 bases per row)
GACTCAAGAACTACCTAGAATATAGTATAGTGAAATGCATATACTTACTTAGGACTACAAAGGGAATGCTAGCAAGCACTTCCTCGTAGCCGACAGACAA
CTAACCATTTCAGTCTCACTTTCCAATTTACCTTCTTTGAGGCACATCAGTAGCCTCCTGCGCGTTACCTTCGAGTCTCCATCGTTGGACTCTCGCCGCC
CTCCTCCGCTTCGTCTCTGTCCGCGTATGCCCAAGCGCAAAAAACGGATTATCCGTCCCGTCACTCTATCGCCGAGCTTTTCGATAAGCCCAAACACGCC
GAGGCTGCCGCTTTTATTTGCAGCACTTTTGCATTCGGTGTCGATCGTCACTTCCGCTTTGTTAAAGCTCTGCGAGATTCGATTACTGACGCCACAGATC
ATCACTCACGAAACGGTTTTGCAAAACCTTTCGGATCTGCTGATTTTTACTCGTCTGGCCGACCAATCAGTGTTTCTCTGTGCGTATCTGGATACGAAAA
TCCTGGAATACGTTACTCGTCGGTCCGCACTTGAGCGCGAGCGTAAACGTCGTCGATTGCACTTATGTGTGTCAAGTGAAGAATCTCGTAAACGTCAACT
CGACGAATATTTCGGATACTTGAACGACGAAATAACCCAAGCCCTGCCTGAGGAAAAGGTAAACACACCTGCCGTATTTTCGATGAGTCGTTAGATCAGC
TGCAGCGATTTCCTCCCGTCTGCTCTGGCCTTGGTCGAGAGCGACCGTCTGCGTCGTTGTCTCGAAAACAACCAAGTCGGTCGTTTGACGCCCTGGTAGA
GGTCGAGCGACAAGTCCGTTGTTTTAAGTACACCGAACACTCGGCAAACAAACATCACAAACTTTAACTGAATAAATGAGCTTTTCTTCACCAAATCATG
ACCTCCTTAAATCCTCAAGGATGGTCTACTGACGCTACCTCGCAGAAACTGATCGAAATGGTTGGCAAGCAGCAGCAACTGCTTGAAGCCACGAATAAGC
GTGAAGTGGAAGTGGAAGGTATCCACTTTGCAATCGCTTCAGTCTTGCGAGTATCAACAGCCAGTCGTTTGGCAGAAATCGTATGGCCGAGGAACGTAAC
TTCGGACTAGGTCAAGAAGAACATGTTTGGATCTGGTGGCCAGCAAATACTCATTCGTTTGAGGAAATCATATCTGCTCTTCAAGAAGACGTCAGTAAAC
GCTTCAATAAGTGGTTGATCGGAACAAGAGTCGAATCACTAACTGGCATGACCGCACAAATCTTGACACGGTACACTTCCTTGTACACGTGTTTCTTCAC
GTTGCGTTTAAAGTCCGCTGCAATCTCCACAGCTGCTTGACTAGCAACCGTTGATGGAGGTGCCCGAGCCACACGTGGAAACGAAATCTCATGCGAGCAC
CAATTGATGCATGGCTGAAACTTGGTAAACCAAGGGTTTCCCAACATGGCATCGTGGACAAATCCAAGTGACCATTCCATGACCTGA