Description :
From Genome Similarity Track
Location :
Scaffold_163:2256- 3273
Sequence
1017 bases(100 bases per row)
GCAATCTTCAAACAGCTTGAATCTTGAAAGATCTTGTAGTTGAAACGCACGTGCTTTCTTGGCGAGAATTTGTCAGGCATTTCAACGCGCAACTCAAACG
CATCTGAGGTCACCGATATCAAAATCAGATTGCAGCTTGCAAGAACGGATACGACATCGTACACACGACGATTCACATCAGCTTGTGCAGTTTCGTTCGA
AAACTCGGGATCACGATTTCTCTTTGCCTCAACCAGCCGATAGCTCATTCCAGGCAGAGCAACTGCATCGATGCTGTCTTGTTGGAACAAAAAGCTGAGA
AAAGATACCGTGGTGGTTGTCAGACACGGCCATTTCTCAGCATCGGATTGATCTTCACACATTTTCAGCACTGCAATGTCGACATCTTCGACGCTCGGTG
TGCCATAGTACCTTTGGCTTACGTCGTTCATGACTTCATTGACATTGCTCTTAATCGCTGCAAGATGCTGGATTGCGGCCTCTTTTCCAAAGTAGAGAAA
GAAGCCGCCTTTTGTTCCTTTAGCGTCATCACATCGAACTCGTTTAATCACTCCGACGCCTACATAATAGAGCAAGGGCAAAACCCTTAGGTAAACCCAA
AACAGTTTGCTGCTGAGCTCGACGCACACTACCTTCCAGCACATGTAGCACATCATATATCCGCCGTTTGCGTGGCACTGAATTGTCAACAAGTGAATTA
GTCATCATAGCTCAGATGAATGGCTAACTGTACAGGTCAGCTTACCTAGCATGTTGTAGACCTCACTAGCTGGGATCTTAATTGGAAATACTGGAGTTTG
GCCATTGTTCATGAGTCTCTGAAGAGTCTCGTGCTCCTTAAAGAATGTCAGTGTGATGCGTGTACTGTGCGGCGACATTCGTTTAGGAAATGTTTAATCG
TGGTAGTGTTGGATTGCCGACTGTGCCATGATTCACAAATGTTACTTACATATCGCCCAAGCTTTTTGCCTTCGTGATCATATCTTGAATCATGCACCAT
GTTGTCGCGGGTAATGC