Description :
From Genome Similarity Track
Location :
Scaffold_12:225572- 227297
Sequence
1725 bases(100 bases per row)
CTTGTTGTCAGCCGTATTCATCGGCGGCATCGGGTAGAGCGATATTACGAGCGCCGCGATAGCTTCTTTCGATCGTGAAACTGTGGCACGGCCACCACCG
AGGAAAAGCAACCCGATCGCCATGCTGAGTGTCATGTGGTTGCCGTAGCTCATTCCCGCATCAACGCGCTGCCTCAATGTTATCGAGCGCAAAAGTGTCA
ACGTTTCGATGTTGCCAGTTCCAGCATCGATCAGGGCTAGCGCCTGTGCACACACAGCTAAGCACCTCTCGATAGTTGCACGTTCCGTCGCAGCAGCAAC
GACGTTGTTACTACCTCGCAGACGCATCGAGGAAGAAGACGACGACGATTTCGCTCTTAACTCCCGAAAATGTAGAACATACTTGCGAAGGGTAGTTCGA
GCGGTCACGTTGCCTGTGCCGGCGAACCGCAGCCCAATGCTCATGCACGCCCCTGCAACAATATTCGCGTAAGCCTCACAAATTGAGTGGAGGTCAGAGT
GCATTGGTGAGGCGCTAGGATTCTCCGTTTGCCCCTTGGCATCATTTGCTTGCGGCTGGATAAATTTGTATGCTTGAAGTAGCTGCACTGGGACTTCGTG
CTGGTCAATCCATTGCACAGTTGGCGAAATCTCGCTCCACATTACTAGGTTCTTTGCTAGGGTGCGGGCCAGCAAGATGTCAGGGCGAACGTAGTCTAGC
AGAATAAGCGTGTCGGGGACTACCAGTTGCGCAGCCACGGCCTTGTTGTCAGTCTGCATGTACATGAATGCTAGTGCCAGAGCGCTTGCACACGCAGTCA
CTCCAACGTTAACGTGTTCGCCACCGCCACGAGCCCCGCCGCGGTCGTTCACGTGTTTTGCGTCACGGCCAGCGCCAGGAGAAGCTCCGGTATTGCTGTT
AGGCGTGTCGTTAGCCGTGGGGTTGCCGTTTACTGCGTAATTGAAACCATTACCCCCGCTGCCAAATGCCTGCCAACGGCGACCACGATAGAGGCAGCTT
CCAGCCACGTTTGTATCCCGATACTGTTGGGCTCCGCCGACAATGTACTTGTGAAGCTTCTCCTCAAGCTTCAAGTCAGCCAGTCCTGGGTCACCTGCTG
TAGATTGACCACGCCCCAGTACGACAAGGCCTAGCGCCATTCCTGCTGCCAAAGCGTAACCCTCCAGCTGATCGAACGAACCTGTTGACAGACCCGCGCT
TCCATTGTTCCCTGCGAATTGGGCGCTTGATGGAGAACGCGCTATCTCCGTAAGCAATAACTCTGTCATCAGGCGATAACCCGTGCCTTGATATAAGATG
CCGAGTCCCAACAATGCAGCCGTCTGAGTGGATGCAGGTACTGAAAACCCTCCGAATGGTGGTGGTAGCAACGATGGAACGTGGAGACACAACATCTTGG
ATACTGATCGCTCCAGTGCCAGTTCTAATCCCGTTCCGAGTAGCGGAGTTTTATCGGATGATGAGAGCTCTGGGAAACCTGAAAAAAGATGATCGGCGCC
AAGCGATGGTTCCTCCGTGTCTCCACTTGCTTGCTCATCGTCCGTCATGGTAGGCTTCACTGCTGCAGTCTTCTGCTTTCGCTTGCGTCGACAGTGAGCA
GCGGTACTAGCCATACCGAGCATGATCGCCACAGTCACAAATTCATTCGACAGCGATAGGTAGTTGTACACATCTGCCATGGACAAGCATTTGAGGTGAC
CGCGTAGACCAATTCCCAGCAATAA