Description :
From Genome Similarity Track
Location :
scaffold_30:225484- 226551
Transcript NameFunction/comments
g2298.t1hypothetical protein

Sequence
1067 bases(100 bases per row)
TTGCTCGTTCCGGAACTGATGAGATCGTCCACGATGCCTCCAAATGTCTTGCGTAGCGTGTCACGCGTGGCGTAGGCCGCAGCTTCATCCGATTCGGCAA
GCAGCTCGTTCATGCAGTTATTTGTCACGACGGGGATATCATTGAGCATTAGGTTCGATTGACTCATGGCCACACGAATATCGTCTTCAGAGATGAACGG
GTCTTGCCTGCGTAGATCTGCCACGGTCATCCACGTGCGGTCTAGCAGTCGCTTCATGTCGTATCCGCACGTAGAATTCGATCCCATTGCGGACTTCAGT
GATGTAATCTCTGTCTCGTTCAACGAGCCGATCGATTCGTCGAGTGTGATATTCTTCATGAAAGCTGCGAACGCGTCCCAACTGGAAACGATGGCATCGT
CATTAGCCAACACTTCTTTCAAGGTGTACTCTGCAGTGGTGAGAACTCGGTCCGCAAACTTGACGCTATCGTCGACCTTGATGTCGAGGCACGAGGCGAT
TGTCACTGGCAAGTCGATGATGATATTGTCTGACTGATACAGTACGGCGAGTAGTTTGCCTTGTGAAGTCTGCGGGTCGGAAACCTTGGTCGAGCGGACG
TACTTGGCCAACGATTTGATTAAGCCCAGCATATTCCTGGCGCACTTGACGGCAACTTGAAGGCCCTTCGCCAGCAATTTGAAGTCCCCGTACAAGCCGA
GTGTGGCAAAGGACAGTGCCGATTGCACCACTACCGATACCTTGGTCACGACTGCGAGCGCACAGTCGTCGTTCTGCCGGATGCATTCAAGGCCGCACTC
AAGGGGGTACGAGTACGGGCACTGAGCCCAACACGTTCCCAGCTTTCCGCCGAAACCGAGCGGACAGGCTTTGGCGATATGGGCTTCGCGATAGCATGCC
GTCGAAGACGAGGTGTCCAGCGCTGTACCAACCCAGTTCACATATGTAGACTCGATCGTGCTTGTAGCATTGGCAGCACTACCAATAGTGAATGCCGCAT
ATCCTGAAGATAGCGAGGAACTCATTTGCGACCGAGACGCACTCACTGCCTGAGACGAGCTGTCGTC