Description :
From Genome Similarity Track
Location :
Scaffold_6:2254358- 2285968
Transcript NameFunction/comments
Phyin_T30-4PITG_04700Transient receptor potential Ca2 channel (TRP-CC) family protein
Phyin_T30-4PITG_04701Putative uncharacterized protein
Phyin_T30-4PITG_04702Putative uncharacterized protein
Phyin_T30-4PITG_04703Putative uncharacterized protein
Phyin_T30-4PITG_04704Putative uncharacterized protein
Phyin_T30-4PITG_04705Putative uncharacterized protein
Phyin_T30-4PITG_04707Putative uncharacterized protein
Phyin_T30-4PITG_04708Bifunctional folD protein
Phyin_T30-4PITG_04709DNA ligase
Phyin_T30-4PITG_04710Putative uncharacterized protein
Phyin_T30-4PITG_04711Putative uncharacterized protein
Phyin_T30-4PITG_04712Putative uncharacterized protein

Sequence
31610 bases(100 bases per row)
TATCAACCCACACTGGCACGTGGCGGTGCTTTGCGGCTCGATCCGTTGAAAAGTCTTGAGTTCTGCAACAATCGTCGGGCTGCGGCTTGGGCAACAGGAC
TTGACAGCAACGACACTCCGGCACCACTAGGGCCTGCGTCACTATCTCCCGTGCGTAAGTCATGCAACAGTTCTCCAAACCCACGTCCATAACTGATATC
GCTGGAGAAAACGTACGCTCGATCTTCTCGCTCGAACAATCTGCCCAAGGTAGAATCCACGCCGCGCGGTCTCTTGGAGAAATAAATCGGTACAATCGTC
TTGCCTTTGTCTTCTGCAAACGCCAACTGGTCGCTCACCAGCTCGGTCTTGACACTGCGCTCCGATAACACGACGAGAAAGACCGAGCTCTGCAGGATCG
CATCTTTCGCCGCTAATATACGCTCCTTGGTGCTGGATACATTGGTCATGGAATCGACCACGAACGGGAACTGGTGGCGACGAAGCTCCGTGCACAATCG
CGTGACGAAGTCGCGATGGCAGTCGCCGTGAGACACAAAGATCGAGAACGTGGGGCCTCCTCCAAACGTGTTTCTCCTCCCACTTCCGCGAACGATCACT
GCGTTGACAATCTCGTCCATCGCTCGACGTCTCAAAGTCGCAGCTCGACCCAACGGTTGGTGCTTGCTCAGAGTCGTTTGAGCCAAGTCTCGATCGCCTT
CAAGTCGATGCATCTCGACCTCGTCTCGCAGTCCGTCGATGAGACTTCGGAGACTCGCTTGGAACTTGTCTTCGTCGATCTCGAACTCGATATGGTCCAC
ACTTGACGTGTCCGATACACTGGAGCCATCTTCACTAGACTCGGCTGTCTTGAAGTGATGCGACGTCACGGCCTGGCCGAACGGAACGATCTGCCGCGTG
AACACGAACAGCTGCAGTTCCTCCGACATTTTTACAGACTCGCAAGAGATTGGCACCACCGGAACCTCGTGCTGTTTGGCGAATGCCAGCTCGTCCATAC
ACAACACACTCTGCGCGTAGCCATCACTGAGCATACACACGATCGCCGACGCGTGTTTCATGACCTCGAGCGATTTCTCTGACGCGCCGCCGCCCTGTCG
ACCCGCCGTGTCGTCCTCCACACTCCGCATGTATACCGTCATGAAATTCTGCTCAATGCCCGCACGCACACGCTCGGCGAAGACACGAAACACGGGGTCA
AACGAAAGCACCACGTCGACACAAGCACCCGCGACTTTGACTGCGTACTGCAGCTCAGCGGATGCGCAGCATTCGACAGCGCGACGTCCTTCTCCGTTCA
ACGCATACAAGTCAGCTTTGCCCTCGACAAGCAAAGCCAGTGCCGTCTCTTTATACCCAAGTCGTAACGCGATGTGAAGAGGAGTCTCCTCTATCTCGGT
GGGGACAAGAGCGTCGACATCTGCTCCAAAACGGACAAAAAGCTCGACGCAATCACCTCGCAGCAGTCCGCCATCCACAGCAAACGCTAAAGGTGTCATC
CCACTATGGTCTAACTGTAGAAAGTCAGCATCTACAGCCAGAAGCTCTTCGACTGCATCCGCATAATTATGACGAGCAGCCCAATGCAGTGGTGTCCGTC
CATGACTGTCCTTTGCATTGACGTCGGCGCCGCGTTTCACCAGTTCGCTGATCACACGATGTCGGCCCATCACAGCTGCCCAATGGAGTGGCGTACGGCT
GTGTACGCCGCGCTGAAACTCGCCGAGAATGTCCGCGCTGATCCCCCATGACAGCAAATGTTGTACAGCAGCGAGATTCCCGGCAGCAGCAGCCTCGTGT
AGTGGCGTCAGCGCAACGTCAGCGCCCCATTCCTCCAGCACAGTCGCCAATTCTCGACGACCCGAGAGCTGTGCGCGCTGAAGAACTGTAGTGCTGGCAG
CATTGCCACCTCCCGGCACCAACAGGAGATTGGCTCGATGTCGGATTAGACACTCGACGACATCGGCCGAGTCCGCCAAGAAGATGGGAGGGACGCGCAT
GGAGCGCGAGAAGAAGCTGGACCGCGCAATGATGTCCAAGTTGGCGCCGAATTTCACCAGGAGATCAATCACCTGCGTGTGGCCGTGCAATGCAGCCACA
TGCAGAGGCGATCCCAGCACATGCGTCACTTTCTTCACTCGTAGTTGACACAGTTCGTACAGCAGCTCGAGATTGAGCGTCGCGCCCGAGATTTTGTCGA
GAAAGTTGGGGTTCAGACCTGCTTCCAGCAACACCGAGACAACGCGCACGTCTCCTGCGCGACATGCAACATGCAGCGGGTTGTGTGTCCGATGGGAGAA
CATCCAGCAGAAGAGCGAAGGCGTCGTATACATGCGGTTGAGCAGCATGTCCAGCTGCACCTTGGACCCGAGCACATGCTCTGCACGCTCCAGCAGTTTC
TCGACTGCTGCGCAGTTCCCACTCGCCGCGGCGTCATAAAGCGCGCCGCGTATTTGTCTCTCCACCGTCCGAACGGTGTTCTGCGTCGTCGCCCATGGAT
GCAGCTCCTGATTCAATGTTAAGTACGAATCTACGTGGTTCGACTGCAAGATCGGCGTCTTCACGCCACTTGTGGCGGGTGTTTTGCTCTCTGTGGCCTC
TGCGGCATTGCCATTCCCTCCCGTTAGCGCAGTCGGGGCTACTGCCATCAGTTCGTCCTCCTCCAGACCCGCACCAAGCTGCAATTGTTGGTGTGCGCGA
AGCTTGTCAAACTGTTGTGTGTGGAGCGCGATAGTAAGAATGGCAAGTAGTGTGACGTATGATACGGGGTCCGTCCAAATGGCCCACACGCCCTCCTCTG
TGAGCTCTCCGAAGGCCCAGTATACGCCCAGCATTAGCACGACAATCCACGAGAGCGACACCGTCTGTACCACCACAATGGCCTCGAAGATGGCGAGCGT
CAGAGTGCGTTCTAATGTCACTCCAGGGGCATCGAAAGCCGAGCGAGAGAGCGAGAAGGAGCTCACCGTCCGTGTGCCCAGCAGTTGCTCGCTTGTAGTC
GCAGCTGCGAACGCTTCGACGTGTGGAATATCAATCACGCGCACGCGGTAGAGAGACACGGAGGGCAGCGCAGCTAGGCCCAGCGATATGTTGAGCGTCT
GTAGTCCGAGCCAAATGTCGAGGACGACGCCTTGGGTGCTGGTGAAGAAGAGCAGCAAGAGAGACCCTATAGAGAGAAGAGATGTTGCCGCCACGCGCCA
TGTATAGTACGAGTTGGACCACTGGAGACACGCATCGACACCTCGCCACCGCAGCCTCGGACGCGAAGACGACGGAGGAGGAGGCGGTGACGTCGGCCCA
GCGGCATCTGCAGCCATTTCAATTGTGTCACTTGGGTGGAACATCAGCTAGCAGTGAAATCGATAAAAGCAAGTGAGAACGGATTGGAGAGGGACCATTC
CTGTTTAAGTAGATGTATATCGGATTGAACGGGGGTGCATCCGACCGAACACACCGTACAGTAGTCGGCTATACGATACAGCTCATGCTCGAGCTTTTGA
GCTTTGCTTGAAGCGCTATCGGCTATCGGCTATCGTCTCGAGCTAATGTATAAACACCGAATGGAAGCTATGCAGGTTGCCTGTCCTGAACTTAGTGGTT
TACAATCGCAAGCCGAGAATTCTTACGGCGACGATGAGAAACACGCGTCAAACGTGCTCAGTGACTTTATTTTAGCCAATTGACGAGCATTCTCTTCCTT
ATCCGTCCAATCATTGGATGAATAAGTGGCGAGCAAAACGAGTCGGTCAACCAATCAAGCAAACGACTTCAGAGAAGAAAGCAGACAAGAAGGAGTGTTC
ACGTCGCGCAACGCAGTGCGCCCACAGACCTTCAGACCGCCAGTCGCGCCACTAACATAGCTACTTGCCGAACATTTCGCGGCCCCGAACAGCCCAGTAC
AGGAACAGGAAAACAGGAAAACAGGTTAAGACTTGCCATGGCCAAGCGCATCAGAGTGGCAAAGCAGGAGGCCGCGCCCGCGGGTCTCCCAGATGCAGCT
AATGCGGCTACCAACACTGCACCCAAAAGCAAGGCGGCAACGCCCTCAAGCGCCGAGGGAAAGCACGTGATGCTGCCCGCGTTTCTGTCCAAGACGTACG
AAATTTTCAGCATGCCCGAGTTCTCGCATGTCTGCGGCTGGAACGCCAACGGAGACACCATCATCGTGTCGCAGCTCGAAGCCTTTGTGGCCATGGTGCT
GCCGCGCTTCTTTAAGCACCGCAACTTTCCGTCTTTCGTGCGTCAACTCAACCTCTATGGCTTCCACAAGACGGTGCTGGACTCGAAGCGTCTCGAGTTC
CAGCATCCGTACTTTAAGCGCGGCCGACCGGACCTGCTGCACCACATCAAACGCAAAGTATCCAACAGCAACCACCACAACCAGCAGCTCGTCAACTCGT
CCATCCAGGTACAGCGTCGCGTTGTCATCACTAGAGCCGGTAGAAGGTTAATTCTAATGCTTTTTTTCTCTAACTATCAGCAGAACTCGCGGCTGGATGC
GCATCGAGAAATCTCCGACACGTTACTGCGTGAGATGAAGGAGCTGCGTCAGCGCAGCGACGTCATGGAGAAGCGTCTTCGCGAGGTGGAGATCGACAAC
GCGGTACGAGCGATGTCCAGGCGTGTAAAAAACTCACTAGCAGACTCATTTTATTTTATTTTGTAATGACAGATTGTACGCAGTGACAATCTCAAGTTGT
GGAAGCACCTGGAGCAGGCCAAGGACAAGCAGTTGATTATGCAGGAGAAGATGAAGAAGATCATGTGGATCCTGTTCCAGATCTACCGCGGGAAGCAACA
GAATCTCCCCAAACTGTCCGGCAACGACGCGACGGGCGCAGTTATCAGCGAAGAGTACGTGTCGTACGCATGTGAACCCTTGGGTTGGCTTGTGTCTCGT
GCCGTGGGATGCGTGACTAACCGTTTATGCTGCTGTGGTGTTTTCTTAATTTCGTGTCTGCTTCCTGTTGGCTCTGAACTTTTTTTCGACCTATTGGTAG
CTGCATCCACAGCAGTATGCTTGGTCCCAAGGAATTTCGTGATGTATTGCGCTTCTTGGCGATGGACGAGCCCCCGCTATTGCCTGGATCGACCGATGTC
GCCACTGCAGCTGCTACGTCGCGAAAACGGAAGTTCGTCGAGGTTCCGTCGGATGTCAGTGGCGCTGCTCCGTATAAATTAGGTGCGCTTATTTTTTTTT
AGGGATTTTGGTATTTATTCTGACTTGTATTTGTCAGATGTAGAGCCATCGTCTGTTATCGACATGTCCAGTGCAGTGGAGGAATCCAACCCGTTTGCAA
TGACTGTGCCGTCCAGCTCACTCACCATGGCGCACGCGGACAGTGTACACAACAACGTGCTGAGCATCTTTTCGCCGATTAAAAGTGCACTTAACAGCAG
TGTACCCAACGTTGATACGACGCTGGGTGGACTTCTAACGAATGGTGTGGCCTCTCCGCGAGTATCGTCGCCGCCGCCGACCGTATCGACGCCTACGACG
TCGACTCCGACGGCATCGGCGCCGACTGCACCTACTGTGACTGTGTCGACACCAAACGTCAGTACATCGGCCGCTAGCAGTCCGGCACCGAGCGAGAAAG
CAGCTGCAGTTGACGCCGCGGCGGATGCGAACCACCAGCTGGCGTTTCTGGACGAAGAACTCCCTTTGCTGCCGGAATCCGACCACTACAGCTTCAGTGA
CGGCGAACAGGTACTGTCAACACATCCTGTGGTCTTTGGTTTGAGCGTATTGGTGCTCTATACTGTAGATTGTGTGGTCTAATGGCGTGTCTTTTGATGG
GCTGTGCATTAGCAGGCAGTAATGAAGAAGCTCGAGGATTTTGAGACGTCACTTTTGGACGAATACGACGTCAGTTGCCTTGACACATTGCTACAGCAAC
TGAAAAACGCTAATGGAGAGAAACCGGCAGGAATTTCGGTGGCAGAACCGGAGGAAGTTGTCGTGGGACCGACCAACGCGTCGCCGAACGATGCGTAGCC
ACCTCAGCCACGAAGTTACATATCCACGTACATGTCAAGCGAGTTGCCGCGCGTGCTGGTCGTCTACAGGTAGGACTGCTGTACATGTCCTCCTTTTACC
GACCGACAGCAGCGTGGTGGCTTGCGTCTCCTCGCCAAGATATAGAAACAGATCGAGTGTGCAAAAAGTCAAGTAAAAAATAAATAATGCGGAGTGATGG
AGGCACAAGAGGCGAAACCCAAGAGACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCC
GAACCGATGACGAACACATACACGCGGCTGGTTTTATTTATGCAATTATGCGAGAATTGAAACAACCAAAAGAAGAAAAAAAAAGTGGAGTAAATATCCT
CATTGTTTTATGTCTTAATCTTGTTCTAAGTGCTGGTTTCTAATTGACTACGTAGTCGTTTGATTTCCTTGTCCTTTCGTCCGAGCTCCAGTTGCGCAGT
TGCAAATAGTGTCGAGATGTTGCTCTCCAATTGTTTATTCGCGGCGCCGAGCTGTCGGTTCTGCTCTTGTAGCTGCGCCAATTCGTCTCGCAGTCGCTTG
TTCTCCTTCTCAACTTTCGTCTTGAGGTCCAGCGCCTCCTTCTTCTCCAGCGCCTTGGTGGACGTGTCCAAGTCGCCGTACAAATCGTCCATGTTGGGCG
TCAATCCGAAAATAAGACTTACAAACTCCAAGTCATTGACCGTTTCAGAAATAATTGTTTCGGAAATTATTGCAATAGTGGCTCACGATGGATTCGAGGT
GCATCAAGTTCTGGGAGGATGGTCAAGCGTTGGTGGCCGCATTCGCCGAGCCGGCCAAGGCTGAGACGACGCAAGCCAAGATCTTCAAGGAGTTGCGTAC
CATGAGTCGCTTCCTGCAGCGCAACCAGAGCCAGCGATTCAGCGACGCCGCTCAACAAAAACTCGTCGACTGCTTGGGGCACTATGTCGGACTGAGCAAA
CAGGGAGGCGTGATGTTCCCAGTGGCAGAAGCCACGTTCCAGACAGTAAAAGACAGCCTCGCTATGCCGTTTAATGTGGTCGGCACGAAGCAGAAGAAGC
GGTTGCTGAAATGGTACAACGAGCTCATCGCAATCGTCGGTGGAGACCCGGACGCAACAATTACTGGCGAGATTGTTGCTGAGCCGAGTATCGAGTGGAG
TGTCATGGACATCGATGAGGACGGATTCTTGTCGCTTATACAAGTGGAAACAGGCGAGACCAACGAGAGTTTTCGGGTAAAGAAGAAGGGCGCAGAGCAC
AAACGAATCAAGACAGCAGTAGAGAACAACGAGGTCATTGTAGTGACAAGTGGCGACGATATTAAGGAGATCCGAGTGGAAAACGAATAGATGGGACGTC
CGTGTCTGCACGTTAGATGATAATTAGAGGTGGCTAAAATGCATCGAGTGTTGGACCCATCAAGGTGCCTGCTACTCCGTTAGAAGGGGCTAGCAGCATC
CGTTTTCTGCCGACTTTCAGTCCACGCTTTGGCGATCGAGCGCTTCATCTCATCGTCACCTTCATCGTACATGTTCTACGACAGGAAAAAGAAGGTTAGA
CTGCGTTACAGTCAGCTGAGAGTCAACGCACGAACGCACCTTCATCATGTCCATGATGCCTGCAGAAGGGTCGCTAGTGTCGGGTTTGCTAGTCTTCAGC
GGGTTTTTGGCCGTGAGGTTCATCCACATGTTATTCTTGTCCGCCTTGTACAGCGAGATCGTGACGCGGTTCTTCTTCACGCGGAACGAGCTCTTAACCG
GGTCGATCTCCTTCTCCAAGTTGTGTTTGACCAGCCTGCATCCCACGTCACTCAGTACTCAAGAGATCAAACTGTATCTCAGCTTCGCCACCTACCGGTA
ATTCTTGCTGTCCAGCCCAATAATCTGTCGCAACAACAGCAGCAAAAATACACGTCAGCGACCTAGTGCGCCGACCACTATTTAAACTGTAGCAGCTCTT
CGCACCTTCAGGTCGAACGATGTCTTGGTGAAGTGGCACGTCACGTTCTCCTGGGGCAAATTGCCGACCCCGTCGATGCCCGACATGATGTAGACAGCCA
CCTTTTCCTTGCCGTATCCATCGTCTTCCCAGCCAAAGCGACTAATCTCCGTGAACGTCGTCAGGTCGCTTGCTGCAGGGCGAGTTGCAGTCACTTTGGC
GGGCTGTGGGTCCACCTCTTTGGGCCCTTCCTGGGGCTTCTTGGCGGCCTCCAGCGCCTTCTGCTTGCGCTGCAGCAGCTGCTGCAGGTCGCGGCGGTTG
CCACTCGTCTTGGTCTGCTCTAACAGCGTCTGCAGCTCAGCGACTTCCGCCGCCAAATTGTCGGTCATGCCTGCCATGATACAGTGTTACTGTACTCAGA
AGTTTTTGCGATCCAATTCGAAAGTGACGGCTGAAAAGGCAACAATTGAAAGCTTTTTCTAGAACAAATTTTGAAAACAATCTAATCAAAGACAATAATT
TTATTCAGAAATTGCAATTAGCACCAGCGACTATTTTTGGATGAGTATTTGTTTCGACCTGGTGTTTCAGCACTCGATAATTATCGGCGCGAAAAGATGG
ACGTTCGAGCCCCGGTCTCGCTCGCTACCGGGGCCGCTAGGGACACGTCGCCGGTATCTCCGCCTCCCCTAAATGCAGAAGACCTGGCTTTAGCGCCTGA
CGGCCTGATTCTTGAAGCTATGCCCTCTGAAGTCCCCGCACAGACAGTGCGAGCGGCGCTATCAACGACGACAGATACGACCCCCAGCGGCTCTCCCACG
CACGCCGCTCTTGTCTCTAACGAGCAACGTACAGGACAAAACAATGCCAGCACTCACGAACTGCCGAACACTCCGGAGACTGAGAGATCAGCGAGCGAAG
GAGTGGCGACTCCAACAGAGAGCGAAAAAGGCGCGAACGGGACTCAAAATACAGGCAACAGAGACCGGATCGGGACGACGGAGGCGGCCATCAAAGCACA
AAATGGAGATATTAAAGCTACAGGACAACCGAAAGAACAGGTCAGCGCTGCAACAGGACAAACAGAGCAGAAGAGTGTGAAAAAGTGGTTCGATGTGCTG
CCGATGGTGTTGCAGAACTTTAAGGCGCAAGATCGCGAACAGATCCGACGTACGCCCTCTATTGAGTGAGCTGCCTAACGATTCACCGACATCTGACGTG
TGTTTCTGCGTCTACAGAGTTGATGCTGCCACGTTGCGAGCTGTGCAAACGAGGCAAAGTGGATAAGAAGGCGGAGGTGAAATGCAATCACGACAGATGC
ATTATGAGAGGTCGTGCGCTGTGTTCTTCTTGCTGGAAGTTAACCCATTCATCGGAGAGCGGACGACAGCACCTCCAGCTTCCTGCTTCTTGTACGTTTT
TTATTCTAATGAAATTAGTGATACTAATTTCGTGTTTCTTATTTTGTGTGTTGCAGTTTGTAGACAGTGCCAACTAGACCACGTCGCGTATTGGTGTGCA
GAGTGTGACTTGCAGCTCTGCAAAGATTGTTTTGAGCAGATCCACAGTGTCCCCAGGACTAGAGGCCACCGCAAACTTGCAACTGAAGGTTTGTAACTAA
AGTCGGGAGATGGATTGATATAATAATTTACTAATAATTTGTTACAGATGCACCCGGAACGTGTTTAGGAAAGTCACATTGGGCTTCGAATTTCCAGAAG
GTGATCTTTCAAATGATTACAGCGCGGAAACGTCCACCTCCAGTGTCCAATGGCAGCTCTGCCGACAGTGTTGGGGTCAAACGGAAGCGCGATGTTGACG
TGATCGTTATTGATGGCTCCGACGACGAGAAACCTGACGATTCAGTGATGAAGAGCGCCCAAGCAAAGTCGACGCTTGCCAATGGAAACTCAGGCCAACA
AGGTGGCAATACAGGGAATCAGCAACACAGCAGCACAACACGAAGCGGGCTGTCGCGTTCCAGTGAACTCTTCTGCCAGCTTCAAGTCCCGTTGCCGCCA
GCTTCTATTAACCCGCCTTTTCAAGCTCCAGCGGGTATGATGGAGCCTATTCCGCTCTCGCAAGCGCAAACCCAAGCGACTTCAACGCCCTTGCCTTCAC
CTGATGCAGTACAGACTAGCGCAGCGTACACAGCGTCGAACACTGTCGATATCAGCTCGAGTATGGGGTGGAACGGCAGTGCGTCTCAGTGTGGAGCTCC
AGCAGCGATGGGGAATGCGAACGGCAGCGCAGCCTACACGTCGAGTGTCATGAGCAACGGGATGAGCACAACGGACGGAATGTGGTCCACAACGTCTGCC
ATCAGCACAGATTTGGTCAGCGCGTCCAATGTCAGTACTCTTCTACCTCTCGGAGGCGCCGTCTTTGCTGAGAACGCGCTGGTTGACTCGTTAGTGGACC
GGTATCACGAGGTGAACCAGAACGTGGCGAATATGGAGCGACAGACGGAACAGCTGACCAGGCATATCGCAGTCGCCACGTGCCAAGGACCGTATGTGGC
GGGGCCGATCATGGCATTGCTGAGCAAGCTACAGCCTATACTGGAGGCAGCGCGAGTGCGGCGAGACAAGCTGCTGATCGCCATGATTATCCAGTCCAAG
GACATCATGGCGTGTGTGCGGGTGCTGCGTCTGGCAGAGCTGGGCGACGTGCCTCAAGTTCCCATGATTAGCCACCGCAAGTGTCTGCAGATATCGACCG
AGATCAACCATCACAAGACGAAGCTCATCGAGTTGAATCAGCATCTCAGTGAGACGCTGACGCAGTCCAGTGCAGTAAGCTCTAGCTGGGAGAGCACCTT
CATCCGAACGACTAGTACGAATATCCAGATGCACGAGAAGAGTATCAAGGAGCTGAAAAAGGCCCGCGAGGTCGAGTTTGTGCGCATTGTGCAGTTCAGT
CTCAAGATCCGCGAAGGACTCAAGGCTGCGTTCCAACGCACTGTAGATATCCAGCGTCAGCAGCAACGACAGGACTTTCAGCAGTATGGATAGTTTTTTT
CTTTCTGCTTTTGCAGCGCTAGGCAAACGGATTATTTAATGGCAACACAATGCACTTGTGTTAACCATGTTGGAACACGAGGAAGCCGATCTGACCTACG
AAGAAGTAGAGCATCCTGTATGTGGGTTTAAGATGAGTGAAAAGGTTGCTAACAATTAACTGAGACGGAACCTACTTTTTGACCTCGTGCGAGACGAAGG
ACCCGAACGATTTGCCCACGATGACATGCCACGCGCCTTGTTGCGTTTCTTCGATCTCGTGTTTGATCTGTTGCGCCACCTCTGTGAAGTGGTTCTTCTC
GCCCTTGAAGAGCGCTTTGAGTGCGTTAGTAGCGCTTGTGAGGATGAGCTCTTCGAGTTCCTTGGACGTGTCCTGGTACACGATACGTAGAGCCCCCACA
GCGACGTCGTCTTTCTTTTGAGCTTTCGACATGGTTGGGAGACGCTTCCTGACCGTTAGACGCTTTCCAGCTAATTCAAGGAATGAGTTTTGGTGCATTT
GGTTCCAAGGTTTAAGCATGACGGACATTTACGAGCGTCTAGTGCATCAAACTGTGAGCTGTGTGTTGTTTGGAGAACCTTCCAGCGGCGCTGTGAGCAC
TGGTGATGAAGTCATAAAGGGAGTTGGGACTGAAGACTCGCTTCTTCACTTATTCCTCCGCGATGGAGAGGACCCTGCTGAAGACGAGGACAACAATGCA
GATGAAGTTCGCCGTGATATGTGGCTGGTTGAGTGTGTGGAGTGGCCCATCGAGCGTCTACGCCGTGAAAAAGCCGCTGTCAAACGCTATCTCCAAAGTC
AGAAGCTTCAGAAGCTGTCGGGTGACATGCTGGTGCTTCATGAAGTGTACGCGCTGCTCAAGCTTTTCCTCCTCGAGAGAGACCCGCACTATCGTCGAGG
TCTGCAACACTGCACCAGCTCTTTTTTAACGTCGCTGCATGTGCAGCTCTCACTGTACGCTACGTACTTTGAACGTGCCTATGGGAGACAGGTACATACG
CATGCCATTTGTTGTCTCTTATTGACTTTACATCTGACTTTGCTACTGTGTAGATCTCGAAGAAGACCGACGTGAAGCCAATTGAGACGCTCTATGAATT
GTTCGTGCAGCAGACGGAGTAAAGAGAAGCCAACGCAATGAAGTTCTTCGTTGACGCAGTTACATTTGCTCTACACGAACGAACTGTGCGTGGGGATGAT
GTCATCCTTCTTGGAATCCATACAGGGCACAGACTGCCACGCGTAGTAGAAAGCAGCACCGCCCATCACGTGCATGACGCCCTTGGCGAGTCCCAGAGCC
GTGTGGCTCTCGTCGCTCTCCAAGAAGATAGCGATGAAGCCCACAATAGTCGCCCCAGCCAGGCATCCCACTGCGTACGTCGCGTTCTGCTTGTTTAAAG
GGGAAATGTCGCTGCTGGGCGTGAGGACGCGACGATATATAAGGCCGAGCAGGTAGCAGACCACGAGAAATCCTTCATACAGTGTCGAGTCCCATCCGTC
CTTGGTCTTGAAGAGCCAGGCGCCTGCAAACGCCACGTAACGCAGTACGATGTTGTGGCTCTCGTCCTTGTAGCCCATGAGATGCACGCAGAGCAGCAGG
AAGTACGAGATGGACAACACGTCGGAGATAAAGTGCCACTGATCCTCTCTCAGGAACAGCTGCGTGGCAAAGGCCTCGGCAGCATTAAAGCTGAACGCAA
CGATAAGCTGCAGCACCCCGATGAACAACTCAAAGTGGCGGCGATTGCGCTTCATCACGTCCAGCGCCGGCAGCATCGCCGCGTCTGTAAGCGCCAGGAA
CACGAAGCGCCCGATCTCCAGCAACATGGTCGAGTATGGCACACGTAGAGCCAAAGCGCAATCTAATCGTGTATTCAACCAATCAAAACGCGTAAAAGCA
TGTGCACCTGTCTAAACAGCTACTATCGAATTAAAAGGGGGCCTCTTGAATGCGAATCCCGGTAGTCGTCATTGTTCAACCTGCGATCAAGTCTGTGACT
ATGGCAGTGGCAGCGTCTCCCATTCTACTGGATGGCAAGGCCACAAGCGACGCAATCTGCACGCAGCTGCAGCCTCAATGTGTCGACTTTAAGCAGCGCT
ACGGTCGCTCCGTGGGGCTGGCAGTTATGGTCGTGGGTTCCCGCAAAGACTCGGCCACGTACGTGCGGATGAAGCAGAAGGCGTGCACTGCTGTCGGTAT
TACGTCCTGGAAGATCGCAATCGCATTGGACGATAAACCTCAGGAGAGCGTAACCAGCGAGCTGCTGGCCATTATCAAGCAGCTCAACAACCGCGAGGAC
GTAGACGGCATCATCGTACAGCTCCCGCTACCATCTTTCTGCGACGAAAGCGCCATTCTCGCCACTATTGCCCCCAATAAGGACGTGGACGGCCTGCACC
CCGAGAGCCACGCCAAGCTCTTCCAGTACGCAACTACCAAAGCTCAGCTAGTGCCTTCATTCGCCCTACCTTGCACACCTGCCGGTTGTCTGGAGCTACT
GGACCACTACAAGATCCCTCTAGAGGGCAAACACGTCGTCGTGATGGGTCGCAGTCAGATTGTGGGTCTGCCTGTGTCGTTGCTGTGTCTGCATCGCAAT
GCTACAGTCACCATGTGCCACTCACACACTCGTGACCTTAAGGCGCGTGTGCTAGAGGCGGATATCGTCATCGCAGCCATCGGACGGCCGTGTTTCGTCC
AAGGAGATTGGATCAAACCGGGCGCAACGGTCATCGACGTGGGTATTAACCCACTTGAGGACGCCACCAAGAAGAGCGGATACCGTCTCGTAGGCGACGT
GGACTTCAACGCAGCAGTAAAAGTCGTACATGCCATCACGCCTGTGCCTGGAGGCGTCGGCCCCATGACTGTAGCCATGCTACTCAAAAACACCCTCCAG
TGTGCTATTCGACGTGCGCAACAGTAGCCAAAACTCTTTAGTGCTTAGGAGAATCACCCAAGGTCAAACTCTTGGCTGCTTATCCTACTAGGTAAGGCGA
CAACAAAGCACAATGTTCCCTGACCCTCAAAATGATCCTCAGTCGAAGAGAAACTCCTGCTCGTCTTCGGACGAGAACTGCCCGCTCTCTTCCACGAGCT
GCACGTCTTGATGCAGCTCCTCCCAATACCCTGTTTGTGCTTGCTCGACTAGAGGAGACGCGTCTTGATCAACACGAAACGAGTGCATGGACGCCTGACG
CTGATGCAGCTCCTGCACAGCTTCCTCCAGTCTCTCCAGCGCCGTCTTCTCACTCGCTGGACGTTTAAGTTTCTCTTGTTCCGCAGCGCCAGCTTTCCGC
TGTGCTTGAAGCAGCAGCCGCATACATTCCAGTTGGCCATACGCGGCAGCGATCTGCGCCGGCGTCTCCCAGTCGCAATTACTCCACGTCGGGTCAGCTC
CAAGGGATAACAAGGTCTGGGTCACTGTAGCACGACCTGCAAACGCCGCCCAATGCAGCGGCGTGTCGCCTCGTTCGTCGGCGACGTTCACGTTGGCTCC
ATGTTGCACCAAGCGAGTCATCAGCTGAAGCGCAGCGTTCGAGTCCACTGCGTAGTGCACGGCAGACCGATGTAACTCGTCGACAGCATGGACGTCGCAG
CCTCCTCCAGGGGTCAAGAGGAAAGCAGTCATAGCCACATCATGCGAGAGAACAGCCAAGTGCAGTGCTGTGCGGCCGTCTGCGTCGCCGTGCGCATGGA
GCAGACGATTCCACTCGAAATTCGCTTCGGTGAGCACGATCAACTGCTTGGCACACTCGACGAACCCCATTCCAGCGAGATAATGCAGTGGATACCGACC
CGATTTGTCGGGTGTGTGCAGCGTGAGTGCTGTCGGGACGAAAGACGCCATCGTCTCGGGTATAGGCGTCTCTGCGATGGAGTCTTTGAGCATAAGTTGC
TGCAAGAAGCCGCAGATCTCCACTTGGTCTTGTTGACACGCGCGATGCAGCACATTCTGGCCTTGATTGTTGGTCAGTCGCAGGTCCGCGCCATGTTGCA
GCAGCTTCTGCATGAACTCGAGGTGCCCTAGCGACGCGTACAACATCAACGGCGTCTCACCGTTGCAGTCGACAGCGTTGACGTTTATGGTCGCACCACA
GGTAAGCAAGAAGTCCAGTACTTCAGCTCGCGATCGATGGTTCTCCTTGGAAAACGACAGGAGATGGAAGGCATTGCGTTGTGTCTTTGGGTCGAGAGCT
CCGAGATCTGCTCCTTGTTGCTGAAGAAACGTCGCGGCTTCCAATGATGCGGCCTCTACCGCTGTGAAGATGGTTCCTGCGTTCTGTGCGCGCGGCGAAG
TGACTGGACGTTCTTGGACACTTGTATCGACTTTTAAGAGCTGCTGACGTCCGGTTTGAGCATGTTGCTGCTCCATGTGTTGCATCAGCTTGATAGATAG
AGGTAACTCCAGTTCTCCGACGTCGTGATAGCGCAGTTCAGGCCTCGGGTTAGTATTGTGTTCCATGCAGACTGGAGACTGGACAACGTGCCAGGCATCG
CTCGCGAGTTCATGCAGGACTTGCTGAATCTCTGACGTCAAATATTCGTTACTTGGCTCGAATAATTGCAACAAGTTACGCGTCAGGAGCTCGTCGAAGC
GAAGACGTAGGATGGAGACGTTCGGGTTGGTCTCGGCTGTTGAGGACTTGGCTACGTTCCAATCCAACCAGGCACGGGCTCTCCAGAAGTAGAAGTGAAA
GTGTTCGTGGTTGGCCGCCCCACCTGAAGTGGTAAACGAATGCTGGAAGTGAAAGTGCATCTGCTGCCGTCGCTGGTGTCCTCGCACACACTTTTGCAGT
ACCGTGGCTGCTTCATGGCAGAACAAAACCTGGTTCACACTGCGTGATAAAATGTGAGGAAGCTGTCGGTGGCTCCAGTCAACGACAGTCGACTCCACAG
CACTATGCACCACATCCACTTGAGCTTCTTCATCACGAGACACATCTGTTGGCTTCTCCGTTGGCTCTACTATCTCCAGTTCCTCTCCTATCGACAGTTC
TTGCAAATTCCGTTCCTGCGACTCGATCGACGTCGGCGTATGCTCTTCAATGAGAGACTGGACTGCTGCGTCTCGTTCCTCTACTCTGTCAATCGCTGTC
TCGAGTTCAACCTCGTTCTCCCTCTCCACGACCGCTCTGTGGGACACCCCGGTCGTCGCAATTAGTCTCCGTCGAGAAACCAATGCTCGTTGTATGCGTT
TCGCTGCCAACGTGCGCTTAGCCGCTATCAGCTTCCGTTCGAGCGCTTTGGCTTGTTGGATTAAACGCAGTTCCTCGCTCTTCGCAGCTGCGCGCTTCGC
TTGTCGAATACCAACGTTCCACTGTCGCCGGCACACTTGCACTTTGGTTGCGAGCACTGAGATCAGGAGTTGGTATTGACGCACGTCCTCGGCGTGTTTC
GCCTCCACTGCTTGCAGGTACAGACCCCGGTACAGCCAGCCTTTCCAGACCGCCTCAATTTTCGTCGCAGCTCTCGCCTGTCGTCGACTCTGATGGTATC
TCTTGACTGCACGTGCGATGCACTGTCCATACGATCTCTCGGTGATCGTCTCGAGTTTCTGCTGCCGCTCTAGCTCATATCCAGCTTGGTTGAAGGCCGT
CGTCGCACTACTGCGTTTACGTTTCTGGAGTCCAGCGTCTCCACCTTTCGTTCGCTGCTCAAGACGCAGATACCGCCATCGTCTCCAGTGCTTTTGGATC
TTCAACGCGTTTAAATTCTGCTTGTGTCGAAGACGCATCTCGATCACTTTCCGTCGCCGATGCGAGATCCCCAAGCTCCGTTGGATCTTCAGAGAGCTCT
CGTCTTGCTCCTGTCGAATGCGTTCGCGCTCCAGTTCTTCCTCTTGTTCGTGGTGCCACTTGAGCCACAGCGTCTGGATTTTAAGCGCAGCCATGTGCTG
CTCGTGCTGAACACGCTGTCGCTCCATCTTACGTCGATGCTGTCGAAGTCCCCAAGTCCGCTGGATGGTCAACGAGCTAGCGTTGCGTATCTGTTCCACC
TGTTGAAATCGTTCGTCTTCCTGTTGGGTTCTCTCCACTTCACTGTGGCTCTGAACTGCAGCATGATGCGCTCTCCACTGCTTTTGAATGGCCAAGACAG
CACAAATCTGGCGTCTTTGCTCGTGCCATTTCTTCCATGTCCGTTGAAAAAGTATCGCGCTGACACGCTGGCTTTCCACCTCTCGTTTCCTAGCTCGCTT
CACTTCTTGCTGACGACGCCATCGACGCCAGTTCCCCTGAATGCGCTGAGCTCCGATGTGCCGTTTACGCTCAGCCTCCTGCTTGTTTCGACGCGATAGT
TTTGCTGTCCAGTTGTGCTGAATTCTAGCAGCCACTGCGCGTTCTTCTTTTTCTTGTTGTTCTCGCTCCGCCTTCTCTACTGATCGCTTACGCCAGCATC
TCCAGACTCGTTGGATCCGCTTGACAGCACAAGTTTCACGCTTTTGCTTCTGCTTTCGTGCTTTCTCCTTCTCGTACTGCCGTCTACACAACCGTCGACG
CCATCTTCGCTGTATCCGAGTAGCTGCCACCGTTTGCTCCTTCCGTTTACGTTCAGCATTCTGCTTCTCCTTATGCCACTTGTTCCATCGTGTCTGGATC
CTCTTAGCGCTCTCCTCTCGTCTACAGCTCCAGTCTCGCCAGCTTCGCCAGCATTTCTGCAGCCTTTTAGCGCAGCATTCTCGCTGGATTCGAAGTCGTT
GTCGTGCTCGCTTGGCATTTCGCCGTCGTTGCCACTCCCTCCACTTCTTTTGGATCACTTGAGCACACGCATTGTGCAGGATACGCGTCCGTGTCGCCTT
CACTCGCTGCGTCTTTCGCCACGTTCTCCACCATCTCTGAATACGAACAGTACTTGAGAGTACAGCGCGATGAGCACGTCGTCGTGCTCGCAGCTTCTTC
TCGAGTACCCACCGTCTCCAAACTCGCTGGATCTTACGCGCGTTAGCTCGAATTCGACAGACTTTCAGCTGCGCTTCAAACGCCAATCGCTGCACGTGTC
TTCGCGCTCGTTCGCCTTGAATCCATCGTCTCCATTCCGCTTGAATCTTACGAGCGCTAGCTCTTCGACGTATCGCTTCGACGTGCTGTGAGAACAACAA
CCTTCGCTCTTGCTCACGCTTCACCCAACGTCTCCACACGCTCTGAATTCTGCGTGCATTGGCTCGAGTTCGAATCACTTCCAGATGTGCGTTAAACGCT
ACTTGCTGTTCCTGTCTTCGCTCTCGCTCACGTTGGACCCATCGCCTCCACACTCTTTGAATTTTTCGAGCATTGACGCGAGCTCGAATCGACTCCAAGC
GCTGCTCTTCTCGTCTTCGCTGTGCTTCAAGCCAGTCTCTCCACCACACCTGAATCCTTCGAGCCACTGCTTGGCACTTGGCTTCTAGTTGAGTCAGTGC
TAGTTGTTGCGCACGTTTAATTCCCATATATCGTCGCCAAACGCGTTGAATTCTCCGAGCATAATTCATGTTCCGCAAGTGTTTCAACCTCGCGAATGTG
TGCACCTGCGTCTTGCAGAGCTGCGCCACACTGGCTAAGCCTAGGCTGATGCCTCTGTCACTCTCTCGTTCAGTCAGAAGCTTCAGCTGGATAATAATCT
GCACCAGCTGAGCTCGCGTACGTTCAGCGATCGACTTGTCCAGTGCTGCCTTCTGCTTGTGCTGGATTTGAATCAGTTCCACTGTTTTGTGGTTGCGCTG
CTGGCTGATGCGTTGGTGCAGCAAGTTCGTCGCCTTGATCGAGGAGATCTCGCTGTTCTTTGCTTCGATCATGTGGCGTTGGTGTCGCTTCTCCTGCTCC
AAGTCGTGCGCTGCCAGTGCTCTGATAGCAGCCTGCTCCTTATGAACTTTAGAGAGCTGTACTCGTCCGGATACCCAGGACGCTATCAGGTGCATACTCG
CTTGGACTCTGCTCTGCTCTAAGACCAGTGCAGCTTGCCGCGCTTGCTCCTCCTTCTCTACTGCCAACAGATTCCTAGCAGCCTGCAGAGCCTCTGAACG
CGTTTCCATCTCCGATAAGCGCTGCTGAAGATCACAGGCAATGGAGACAGCAGTTCGACGCTGCTCCAGCTGATCTTCACTGGACATGAACTCACTCTCC
GTCTTCTCGGCTTGTAGCTGTGTTTGATGCAGCAAAAGTCTTCGTCGCTCACGTTCTGCTCGTCTACAGAGCGTCCGCGCGTCCATAAACGCCTTGATCT
TCTGTCTCGCGACGCGTTCTTGAGAAATCCGTTCGCGCTCTTGATGCGCTTGCAGCATTTGACGATGCTGAGCGTCCGTGTGAGTCGCTTCTCGTGACAT
CCGGTCAAGTTTGCGCTCCAGTACTCGCACTTGAGTACGAGTCTTACCGATACGCTGTCGACTGTCAACGTCCAGCTTCTCCTTGGTGAGTACCTGTTCT
TTAAACTTAAAGTTGTAGCTTCTCTTCTCCATTTCAACTCGTTGCAGCTTCTCGTGCAGAAGACAGAGACGGAAGAACATCTGGATCTTCAGTGCTGCGA
GGCGTCTCTTTCGTACCTCAACAGCTTGCTGTTGCTGCTGCACCACGCGCTCGTGGTGCGTTAGCAGCAGTAGTCGCTCATACTCGGAAGCTTTCCACTT
GCGATCGAGGTCTGCGAACCTCGCGTTCATATCGGCGATCAGTTCGATCCGATGCTTGGAATCAAGCTTCATAGTACGCTCCATATCTCGCCTCGCCTTC
GTCCACTTGAGCTGCTCCTTGAACAGAATCTTCTTGGTCATCTCCTGAGTCGCCTTCAGCTTGCGACGCAGTAGAATTTCCTTCAAGAACTTCTGAATAT
CCCTGAACGCCCTCGTTCGTCGCTCTCGCTCTCGAGCGATTCTCTCGTATCGCTGTTCCTTCTTCTTGATAAGGAGACGCTGACGTCTCCACCACCGCAC
GATTCTCTCCTTTGCATCTTCGCGTCGACGTCGTCGTCTTGAGATCCCCACGAAGAACCGCGCGCGATGAAATGTCATGTGAACAGCGCGAAAGTCAGCT
TGTCGCTGCGCTACGGTCATATAGTGGCGGAATATTCTCCAGTTTCGCTGAATTCGCGTTGCTGCGAGGAGCCGACGACGATTCTCTTCGTAGGAACGAG
CTTGTTTACGTCTTCGATGATGGTCAAGCACAAACATTCGGATTTTCCGTCGTGCCACCAGTCTACGCACCACCACTTTAGCTCGTTTGTGACCAACCAC
CCAACGTTTCCACGATGCGATGTTCCTTTTCAGCATCTTTAGCTCGCGTTCCAAGTATTTAGGAGCGTTGTCCGCTTTGGACACGCTTTGGACAGTGGGC
GATGCGTAGCCCAAAAGACAAGAGAATGGCTGAGCAGCTGACTGGATATATTCCTCCACTTCTCGTTGCGATACCCAATGACTCATGTCGAATGCCGCCA
CTTGGATGTCGCGACAGAGCGAGAAGATGCGGTTCAACTCGGAGCCTTCCTCTTTAACGTCAGCTTTGAGATTTGCTGCTGCTGACGGTGGCAAGTTCGA
CAACATGCTTCGAGAAGATACAGAAGACGAATTCGCCGTTCTCTCACTTGTCAGGTCAAAGCCACGGGGGGCCAAAGGCAGCAGATGAATCGGCTGGGTG
ATCAGCTCCACAGAGACGTTGCTATGAGCTGAGATAGCAGAGATCTCGCCCATTAAGCCTTCGTCCGCTTCGACTGAACATCCTTCCACTTGAGATACGA
GAGAGCGGTCGGTATTGAGAGAGTCTGCATCTACTTGAACGTCAGGAGCAGAGAAAATGTCACCTCTCGAGACACCAGGCAGTAGACTCAAAGCCATCGC
AATACTCGAGATAGCGGTGCTTGATGAGTACGCGTACTCATCGTCTTGTGTTGTGGGCGTCTGTACTTTCTGGTCGACACTTTCACGTCCAGTTCGACTA
GATTCCACACAGATACCAAGCTCGAGCAGTGTAGACGTAGGCGTTGTGTAGTCATTTGACGCTGTCGTGTTCGGGAGTAACACGATAGCGGAGCCTTGCG
GTTCAATAAGCGGTACTGTTTCTGCTAAGGTTGAAACTTCATCGGCACGCGGGGATTCAGTAGACGAAAGCGAGAAGTCTGGCAGCATCTGCAACGCCAT
CGCGATACTGGACAACGCAGAGTCGGACGAGTACTCAAAGTCGCACTCGTACGCGTTATCGTCGCTTGGTTCGGCTTCACGGATGTCCTCTGCCTCGCAC
TCGTCAGGGACTGCCGTTTCTATAGCGTTAACTAAGCGATTCAGCCTCTCTTCGACCGTATCGCGTGGTAGGACCGACGGCTCCGTGACGGGATTTAAGT
TCTCGCCATTTAACGCTGGTACAACGTCCACGTCAATGACTGAGACCGAAGACTCCCTACCTTCTTCATCTTGAAGTGACCGTCCGGACGAACTCCTGCT
GGTTGTTTGCGTCGTTGCCACTATCGGGGTGTTTAATTGACTCATTTGGACTCCGGCATCAGCGAAAGTCGCCTTAGCAGTTCTGCTTTTCTTTTGGGAT
CCAGATTTATCCAACGAACTCGACGACTTTGCAATTGCAGCGGTGTTCAACAGCGGGATCAGTCGCGTACTTGCCACATTGGCATCAGTCTCAGTCGTCG
AGTTCCTTGATGCATCTGATCTCACAGAGTTCTGGTCTTTAGGACTTGGCAGCTCCGTCCACGCCGAAGATGGCGTCGGTACTTTGCTGGTATTCTTCTC
TTGAGGCTCATCAGCAAGACTGGACGCTCTTGCCTTGTGCAAAGTCCTTCCATCCGAAGCTTTCGCTGGTGGCGAGCCAGTCCACGCTTCCAGCACAGAT
CCGTCACTCTGAAGTGATTCGTCATCTCTAAAATACGCTTGCGAGTCCTGTCTATCCAGCCGCTGTATCCTGTCATGCCCAAACGTACCGTAGTCATGAG
AAGTCTCATCAGGTCTGTGAATATGCGTTCTGTAGCCACTGTGCGACTGCAGATACCTCGGAAGCATCTGAACAGCATTCGAACGGGTCTCCAGATCCAT
GAGATGCAGTAATGCCGCCGCCACACGCGCTGCCGGTAACACCTGCCAGCCGGGAAGATATCGTTGAGTCTGGAGCGCGAAGGTTTCGAGCCTTTGCGTC
AATAATTTCAGCAGCGACGACGACGACGACGACGCAGAGCAGAATAACCCACTGGACGTAGCACTTTGATGACAGGCACAGAGCAAAACCTCCGAGGAAT
CCAGAGATAATCCATCCACGAAAGGGTTTCTCGCCAAGCTGACGTCAAAGTCTTCAAAAAAACGATGGAGCTGCGGAGAACACGCTAGAAACTCCGTGTC
GGACGACGCCATCTGCAGCAAGTATCTGTAGAAATCCTGCTCCAGAATCTCGTGCTCGTAGCTCCTGGTAATCATACTTGACGCTCCAAGTTCGCTGCTC
AGATACACGACAGCTTCCACCACTGCGAGCGACAGACTGCGCATCCTGTTGAGCAGCTTGACCACTCGTTGCGGCACGTTCTTCTCCACATGAGACGCGC
GATGCAAAGGCAACACGCCCATCAGTTCTTGCTGTAAATGCGCCATCACTTGGTCGCGCAGGTGGATGTTCTGTTGGACCGACTCGACCACAAGTTGAGC
CGGCGATTTGTCTAGCGAGGACGAACGCGTCACGCGCTGTGACGCGTGGAGAGCAGTCGAAGTGTGTCGAGAGCCAAGCACCTGTTTCTTGAGCTTGTGT
GGACTGGAAAGGCGTTTGGCATGAGCTTGCTGCATCTGACGCTCGGTAGGAGTCCTCGACTGCAAGCGTGGCCTTGCTTCAGCGATATTGTGGTGGTCGT
ACCTAGGATGGACGTGTCGACTGTGGCGGATGGCTCCAGCAGAGCTCGGTCGCCTGTTGTCGCGGTGCTCCATACCTGACCGAAGCGAGTCGTCCAGCTC
CAGCTCCACTAGCAGACGCTGCTGGTCGTGATGTCGACGTCCACTGAGCTCCGAGGTTCGACGCATTGGCCCACCCCACATTGTACTTCGGTCGGCCATA
CCTTTTGTATAATTAGGCGACACGAACCAAACTGCTGGGACGTTTCCTGGATGCGTTTCGCTGCTCAAAAATCCCAATAAAGTTCAAGCAACTAGCAACA
ACACATGCAGCTCCAGAGCTAGATTTGGTGAGCGTCTTAAAAACGAGTTATCAATGCCAATTTGTACCTAGATAAGCATGTCGTCCTCTTCCTCATCACC
ATTAGTCAAAGTTGTGAGACCCTGGGCTCGGTACAGATCGGCAATCTACATGCAACGGTCTCGGGCGTTAGTGGTCTGCTCATATAACAGTATAATACAA
GCCACGTCGTACCTGCGAAGAGTTGGTCGCCTGCGTCGTGTCCTTGTCGTCTCGGATGCGAATAAAGCGAGGGAAACGCAGAGAGATGCCTCTATCCTTG
GCCACCAGACCTATCGCTGCCGTGTACTTGGGCGAGATGGACAGATCAGCACCTAGAATCTCCCACACACAACTCGCCTCGAACCAAACGTCAGGTTTGA
TCCCTTCGCCGATCGCATAGTCACTAGGAGGTTTATCCACGACCTTCTCCTTGAGCTGCGTGTAAAACTGCTTCAGCACTTCATCCGACAGCCCAGTGCC
CAGCTTGGTAATCGGTTGAAACATCTCCGTATCGGGGTCATAACAGGCCAACAAGTACGCGCCGTACACGCCCGTGCGCTTGCCACGACCATAGAACGCT
CCAATCGGAACCAAGTCAGCCGAGTCGCCGATACCGTCCAGATAATCCTTCTTAAGCTTCAGCCACTTGTGCGAGCGGTTAGCTGGCTCGTACGTCGCCT
CCTTCTCCAGCGTCTTCACCATCAAACCTTCGCAGTTTTCACGCACTGCCTCCTCGAGGAAGTTGCGGACTTTGTCCACCGCTTCTTCCATCGCCTCTGG
GTTGTCCTTGACGTCGACGCCGTCCTCAACGTCCAATGAAGTGGCAAATTCAAAGTTGCCGGGCTTCACGTCGAACATCTCGCGCAATTTTTCACGACGT
CTGGCCAGCGGGACTCCGAGGAACGACTCGCCATTCAGAAACAGCAAGTCGAACGCGTAGATGCACACAGGGATCTTGATATCCTCCACTTTCACGTTCT
GGCAGTCACAACAAAGCCGTCAGTATACCCACCTTCAAGCCAGGGTATTTACACAGCACCACAAACCTTTCGCGAGCGTGTGCTCAGGATCTGGAACGGC
AGACGCTTGTTAGTAGCTCGATCCACAGCGACCACCTCGGCGTCAACGATGCAGCTGTCCACCACGCCCTCCTTCGCTGCGTTCGTGATCGCCAGTTTGA
CGTCGGGGAAGCGCTCGGTCGAGTTCTCAAAGTTGCGTGAGAAAATGGCAATTTCTCCGTTCGGCAGGATGTGGATCTGCGCGCGTTCGCCGTCGTATTT
GTACTCGCACGTGAACGGTTTGCCTTCGAAGCGATCGAACACCATCGCGTACGCCTTCGTCGGACGCGCCAGCATTGGCGACACTGGAGTTCCCGGCGTC
AGCACGCACCTGTCCGCCACCTTGGCAAACTCCTTGACGCGGAGGAACGGGGCGCTCTTAACCTCCTTCTGGACCTCGTAAAAGGCAGCAACCAACGCGT
CGTAGCTGGGACACTCGGCAAAGGCCTTCTTGACGAAGGCAAGCGCCTCTTGCTGCTTGTCCTTGTCCTTGTACTCTTTGTCAGTCATGAACGCGTACGT
CAGCCCCATCAGAATCGACTTTTCAGCCAATCCAATGCGAAGTTTGCCCTGAAGGCCTCGAATAATATACTTGGCACCCTCGGCAGCTGTCTGCGCGCCC
TTGTCCTTCTTCTCCTTCTCGCACTTGACCAGTAATCCCTTGATAATGGAGCACTTCTGCTGCTGCGAGTTGTTCCCAGTCATCTTGGCGATCTTGACAA
ACTGACTGTACACATGCTGCACGGTGAGTCCGCTGCCCTTGGCCGTCGCGGGTTTAAGCGACGCGAACGACAGCGTCTTCTGCTTGGATCGCGCATTCTG
CGCCACCTTCCCGAGGTCTCCTTCCTTGTGATACATCTCCTTAATAAACTTGAGGTTCGCGCCCGTGGCTTCTCCGATGGCTTTCATGAGGATGGCGTCA
CCAATGCCGATCTTCAAGTTCTCGAACGGAGGCGCCAGGTCCACACAGACGCAGAGGTAGATACAGGCGAGTAGATCATCGGGAGAGCGACGGATGACGC
CGCGGAAGAAGGCTGTGAGCAGGTCCTGGATGACGAGACGACCCGTGACTTGTTCGATCTTGGAGAACAAGTGCGCTAGCTCAAAGTACGGCGTCTCTCG
AGGCTCGTCGGTGTCTTCTGTCTGTTTGTCGCTTGTAGCTGACTCGCTCTTGACCTTGGCGTCTTTCTTGCCATCAGATGAAGTCGACGTGGCCGTGCTG
GAGGCGGCAGTGAAGAAACTCGTCTTGGATGCAGCAGATTTCTTCTTCTTCTCAGTCTTTTTGGCCTCTTTCTTCGGCTGAAGCTCTTCATCTTCTTCAC
GAGCTTCGACTTCTTCACTCACTTCCTTTGTAGGACTCTTTTTTGCCTCCTTCTTGGGACTCTTGACCGCCTTCAGAGGGGTCACGACTTTCTTTGCCAC
TTGCTTCTTGACGTTCTGCGGTGTCGACGTCGGCGACGTCATGTCGATCACCTCCTGCTTTGCATCTTTCTTGTCTGTCGTCATGGCCAGATCCAAGTCG
CTGTCCTCGTCCTCTTCGTCCACGACGCGTTGACGCAAACGACGCCGACCAGCTGCAGCAGCAATACAAGCAACGTGAGTCATGTGACCTTCACTCTCTC
TCTTCTTTATGTCGATACGTACGCTTGGTCTTGCTCTTAACGTCTTCGTCCTCCTCGTCTTGCTCTTCAACATCCACAGACGTCGCCTCTTCTTGCATCT
CGACGTCCTCCGGCTCTTCCTCCACCTGCTCATCCTTCTCTTCTTCTTCAACTTCTTCTTCTTCTTGTACTTGTTTCTTCTCCACTTTTGCCTTCTTCAT
CGGCTTTACAGGAGATGCGGCGGGTTTCTCGGCATCGTCTTCTGCAGGTTTTCGCTTCTTGGCCGGCGGCGATGCACCTGCGCCAAAGAACGACCTGATA
ATGGTGCACGCAGATGAAGGTCAGTGAGTGAGTGTACAAATATGAGACGAATAAAGCCTCGCGTACATGATGGAGCTCTGCTTGGGTACAGCCTTCTTCG
CCATGCTGGAGCAATTTGCTACTGACCCATCCAAACCAAAATGGCGCCAAACGTGTACACCAAGCGTACACAGCAATAATTGTCAAAAGTTGATCTTTTT
GTGGCGGGAAACACCTTCACTCTGTCGAACTTCCTGCAATTTTTTTTGGTTCAAAATGGGTCGCAAGTTGCTCGCGCTAGTACCATCAGAGTTGCCGTCG
TCTGTCAACTTGGGGCGCTTCCATTCGGACGCAACGGACGCCCCGCTTCTCTCTGTTGCTCTGTGGACCTCCCGCCCCACTGCAGAGTCCACTCGAACGC
GACAATTGGCTTTGGACAAAAGCAAATGCCAGCTCCTGGAGCTTCAGAAGCTGCAACCCGTCGAGGGTGCGCGCAGCTGGTTCGTGGGCAATAGCGTATT
GCAAGATGGCGGGTTGATGGTCTTCTCACCGGTGGATGCACTCTTCGTGCTGTTGGATGCGGCGTGGGGTCAGCGCACCCGCTTCTCATCAGTCTACGAT
CTACTGGCACGGGATGGCAACACGTGGCTGTTGCAACTCACTACGCTCCGGTCAGAAACGATTGAGAAGATCTGTGACCTACAGGCGGTTGGAGACGAAG
AAGGAGTTGACAATCTCTTCGTTCAGGCTAACGAGAGCAAAGTTACGAGCTGGTTGAGCGCCAAAGTGGAGAAGGTGGCGGCTGTGCTGGCAAAGCAGGA
GCTAGACGCAAATGCCAAAGCTGCAGCTGTCGATGACCAAGTTAATCTACCGGGATACGAGAAAAAAGAAACGAGCAGTACCGTGGCGCAGGAAGATGTT
GCACGACATTACCGTGAAGCGATTGATATCGTGGGCAATTACCTTGCGAGTGACTGGATTGACGTACTCTGCGACAAGTTCAGGTACGTTACGGTACTGC
AAGAGCTAAGAAACATGTAGTAATGTTGACGCATGGTACTGTTTACAGAGTGAACAAGATGGTTGAAGTCAAGGTTGTTGCTAAGGCGGCACCACAGGAC
ACATTCAAGCGGTTCGACCGACGTCAGACACCCGAGAATGGCTCCAAGAGACCAACGCCGTCCACCGCAGCCAGCGCTAAGAAGAAGAGCAAGTTGGCTA
GTGTGGACCGCACTGGTATGAAGTCACTCACGTCGTTTTTTGGCAAAAAGTAAATGGTCAAAGTGATGCATTTTAGCAAATTATAAAGAGCAGCTTTATC
TTCGAGCGCTCGAGCCTTCCACGCTGATCCGATGCACGACCACAAAGTCGTCCCAGCCGGAGACGATTTTGAATTTGATGAAGGACGCATCAGTCGGCTT
GACGTTCTCGTTAACAATTTGCATTTCGCCTTCGGCCTCCTTCAACTCTGGCAATAATAATTGCACGAAAAGGTCAGCTGGTGATCAAGTGAAAAAAACA
CACGCAATTTTCTCATGTTGCTTACCTGAATCAAAAAGTTTAACCCATTTTGTAGGCGTCGGACCGCTGCAAGATTCTATCGACACTTCCTTGGCATTTC
GCGTCCACATTTTGGCACGAACAACTGACGCCGTTGTAGCCAATTGGACTACAATTTCTTGAGGAAAGCTTCCAGTTGTCACCCATTTCGACGATTGTTC
TCTATTTCATCAGCAAAGTGACTTTAGCAATTGCATGCAACAGCAACAAACACTTGTCAACAAAGTAGTACCTACCCATCCAAGATATTAACCGGCGGGA
AACTCGGGTCATACGATGTCACAGCCGTCACCTGGGCACCTTCTTCGTCCAACGCAAGCTCCATCACGATCACAGCGACTGTAGGTGTTTAGCAAAATGT
CCCTTTACCAGTCTGCAAGGGTTAAACTTAGACACCAAAAAAGAGTCGCAAAAAAGGTAATAATAATAGCAAAAGTCGGTCACGCACTCATACTTATCAG
GTCGTTTTTGGGCTTAGTTGAACACCCTTTTAGATACCAACGTCACAGATGGCCCATATGAATTCTGGTTACCCACTTCCACGTAGCTCCGATGTGCCGT
AAAAGTGGACTCACTAACCTCTCCAGCACCTCATGAAGTCAACGGTGCCTCAACAGACTCTTTATACAGGCGCTCGAAGCCGGCCGACAGGATATCTGCC
GCTCGTGTGATGCCAGACCCGTCGTCATTGAACAGCTTGCAGTTCGACCACATCAGTCGAATATCGTTGGCGAAGTGCGTCACATCCAGCTTCTTGGCAC
CCGACGCCGCCATGTTGCTGTCCACGACGTACGCGCCTTTCTTCAGCTTGTTCTCGATCTTCGACAAATCCATGGGCTGCTTCACCACCCGCGTGTACAT
TGGCACATTCTCCACAGGTGTCAGGAACGGCTTCGAGAACGGGTGCGACTTCAAACACGCCACAATCTTCAGACACCTGTCCAGCAAATTCTGCTCTGCA
GCCACCGCAGTGGAGTATCCGTCAAACCGCGACGGTTTCTTGCACTCCGCACACTGCCAGTCGCCCTCTGGAAGATCATTCTCCGTCATGTGCAGACACT
TCAAGTGGTAGGAACGCGGACATTTGTCGCAGCAGACGAGGTCTCCAGCGCCCTGACAAACCTCGCAGAAATCTAAGTTCGCGTCCAGTTCGCTGTCCGA
TCCGCTGTCGTCTTCTTGTCCCTCATCGTCTTCTTGACGGAACGACTCGTCCTCCGTCTCTTCGTCATCCTGTTTTACTCGCTTCGGGCGCTTGGGGGGT
CGACCTCTTCCCCTCTTCACAGGAGGGGCCGGCTTTTGTGCATTCTTCCTCACTGGCGGGGCAACTCCCTCAGGAAGAGGATGTTTGCGAGGGCGACCCG
GTCCACGATGAGGCGGCGGAGTCGTCGTATGGCTCTCCTTCCTTTCGGGCTTCTGTGTGATCTCCTTCTCCCCACTCTTCGCGCTGAGCTTCGGACTAAC
CTGGGCCTTGTGTTGGGGCTTCTTGTCATTACTCTGTTCTTTCGCAGCGCTATCGTTACGGCGTACAACCTTGGAAGCATCACGTGACGATATATCCTCC
GAGCCACGCGGTGCCGGACTGTCCTCGGCGGTACTGTCACTAATCTTTCGCTTCCGTGTCGGCGTCTGGTCCAGCGGCCGCGCACCAACAGTGGGACGAC
GCGGACTGTCGGATTCATCTGAGCTGGTGGAAGACTGATCCTGATACGGACTTTTATCTGGGCGGCGACGGTCAGCAATGCCACGTCCAGCGAACGTCCG
TGGAGACGCCTCCATCTCAGTATCGCCAGAACTCTGTGTGTTCCCGCTGCTTCCGCTTCTCGCTGCGATTCCGTTCGTGTGAGTGTAGCGAGCATCACTT
GGACGTTGACTGCTGTCCTTGCTCGACTGGCTACTGGCATCCATCGCAGCTGAGCTCGCAGGGGTCCCACCTTGATTTAGCGAGCTCAACAGCTGCACCA
ACGATTTCTCCGACTCGGCACAATTCAAAACAGTCGCTGCTGATGGCGATTCCGCGTGCGCAACTTTTGGCGACGCGACTCGAGCTGCCACGCGAGGATC
CGAAGCTTGTGCGGATTCCGCCATCACGGCGAGCATACCAGACGACGTATCCTTGGCTGCACGTTTCGGAACAGGAGACGGGGACTTTGGTTGTGCCTGC
ATACTGGGGGAATATCCGTCTCGAGACGTCTGTTCCTTGTCACTCTCGGCCTGCTTGAGCTGCATCTGTCTGCGTACGTCGTACGCTTTTCCTGCCTCCA
CACTGCGAGCTGGTAGTCCGTCTCGCTGCATAGGAGGACGGGCTTCTGCTGGAGGTGTGGGTGGATACTGAGCGTATCGACGACCATCGCTAGAGCTCGT
ACTTGGAGCACTCCCGTACGTCAATCGACCGTCCGAGGCCGGGGCAGACAATGCAGCTTTCGCAGCAGCAACGGCAGTAACACGGTCGTCCTTGGGCGCC
ATTAATGCCCCTTGTCCACTACGACGTAGCGTATCCATAAGATAGCGTTTGTATTTCTGCACCTCCACCCCTTTCTCCGCCGTACACCTTGTGCACGGAC
ATCCGCGCGTACAGATCAAGCAGCGGAGTAGTCGACGATTCGGCGCCGAGCCGTTCCTGCCCACAAACAGCGCTTCCAGTCGCACTCTATACACGCTGCG
CAAATGTTCCCGACACAGCGAGTGCTGCTCATCTCCATGTGGACAGAAATTCACTACTGGCATAAACTGGCTGTCACTCGCTCCGCACAAGTGACACAGT
CCTTTAGCCACAAAATTGGCTTCTTCTTCCGGGATCAAGTCCTCCATCGCCACAGCATACGCGTCATGCAGCACCGACTCGTCCAGATTTACCTGCTCTC
TTAACATTTCCTCTACTCTCGGAGGCAACTTCCTCTCCCTCTTGTAGTCCTCCGCCATCTTGCCAGAAGACGACGACGTCTCGACCATCCTGCCTTGATA
CGACTTCCCTCCTGCAGATCCATCCGCTACGCGTCCCTGATAAGCTGGAGAGCCCTGGACAAGTCTCCCCTGGTACACCACTGGTCCATCCGATGGTCTC
TCCTGGTAACCTGGCGGCGGCTCCATCCTTCCCTGATATCCTGCATCCATTGGTCTACTCTGATACCCCGCAGAGTTCTCCATCGCTCTACCTTGATAGA
CAGGACCAGGCGTCGCTCTACCTTGATAGCCATTAGGTCCGTCCACTGTTCTCCCTTGATATGTCGCTGCTCCGTCCACCATTCTCGCTTGATATCCTGG
ATCCATAGGTCTCCCTTGGTAAGTCTCCGGCGCTCTCCCTTGATACGAGGGACGACGTTCTACCAGTCTTCCCTGGTAGCTAGGGGCAGTTGAGTAGTGC
GGATACTGCACAGGTCCCTGAGGACCCGACGCTTGAGGGTAGTCGGACGGCGCTCTCGCTCTCCCTTGCCAACCTGCAGCCGAAGACGTGGCCACCCCAC
TGGCCGTGACGGCCGAGGCAGGAATGTATCCATCTGGCGTCTTACCCTTGCTCATGATGGCCTCCATCCACACTTCGTTGGGCGGGGGTGTAAGGCGTTG
ACGCTTCTGGGTTGGAACATTTAGAAGTATTAAGGGAAGAGAATAAGGTTAGAGAGGGGGGAAGGAAGAGAAGAGAAGAACAGGGTGAACACTCAAGCGG
CACCTTGTCCCCGCGGTCTCGAGGCGCCCCGTGGTACATGCTGCTGCTGCTGGCCACGCTTCCTCGCTGAGCCGTCGGCGGCTTGTGCTGCCTTGGAGGC
TTCTTGAGATTTGTCGTTAGCACCACAGAGACTGGGTTTTTGGCGCGACGCGGCGACGTGAAAACGAATATATTGACCAAGAACATAAGGAAATGGTGTT
TAGTATAGAGTTGAGGAGGTACCCATCGCAGATGGTGCTTGGAATTACAGTTCGGGCGCCGCCCATGTGTTCCGGCATCATCATCATCATGAACGGCACG
CAAACAACCA