Description :
From Genome Similarity Track
Location :
contig_47:22537- 24066
Transcript NameFunction/comments
g9609.t1hypothetical protein

Sequence
1529 bases(100 bases per row)
GGCAGCAAGTACAGCTTGACTTCACGTAGCTCCCACGTCTCCCAGAGCGGCGACGGTTGCGAGAGGTACACACACAAGCTGTCGAACACGTGCGGGTTCC
AGCTCACGGGCAGCTCGTCAAGCTTGACGAGCTGCCAGTTCTGCGCATCGTCTTCGCAGTGCACGTGTTGCATGAGCGGGTAGGCGGCAGCCAGCTCTGT
GCTTGATCCGTCGGCGTTCACTTGCACGATCCTCATCCAGGCCACGTAGAAGTTGCGGAACACGAGGCAGCAACGATACGGCAGCTTGCGGGGTGTCAAC
AGGGACAACTTGAAGCCGACACTGCCCGTAGCATTGACGCTGGGGTTCACGGACTTGGTAGCGGGCGGAAGCGAAGGTTGCGCTGGCAGGTGGGAGACCT
GGATGGGAAGCTCCGTCATTTTTGCAAGCTGAAGTGGATGCTACACGCGAAGAGACGCGACGTTTCGTTGGACCAATCAGAAGGCGGTATTTGGAGAAAG
TTATACATGGGTACGAAACGTGGCGCCTTGTAGCCATGTTACACAAAGGCAATCTCAATCAAGATACTTCCGCCGCTTGATTCAAGCAGCTTGATAGAGT
TACCTCACTGGTACGACAAGCAAAAAATATCGTGGTGCAGCGAGGTATCGAGCGGAAAAGTTGAGGGCGGTTTTGCAGCATCCACTCCGGTGCTCGACCC
GGGTATGAGTTGACCAACCGTTGTTCGCAATACATGTGAGAAGCAACTGGGGGTGGGCGGGGTCCGCTCAGCCTGCCCGGTTCCTCTCCGTCTCACCAGC
CCACATCCGGTTTGACGGTTATGACTTCTAGTAAGTGCAAGAGTTCTCAGACGGTTGAATAAGGTGGAGAATCGCGAAGGTGAGGTGTTGCAAGGAGCCA
CGTGACAGACGAAAAACTGCAGGAGTTCCGGGCGCAATAATTGGTCGCAGTCTGTCAAACACTGCAAGTGACGGCGAAAATCCCAAGAATACGTGCATCG
AGGAGTACGACTTACTTTCGAGTCGAGATCGACCACACTTATCCTCCTTATCGCCTGCATTTAGCTGCTCGGGGCCTATACACCAATTCGCTGTGAACTA
AGCTCCATACACGCAGCTCAGACTCAGAGCTAATAAGATAGCAAACGGCATTCTGCGCTGTCCAGCAAAAATACCGCCCTATTGTTATCGGAGTCACTCT
GGCATCTTGGGCTCCGAGCACGTGAGACCAAATGGAGACACGTCGATCCCAAATGGGGGCCCCAACCACTGAAGCCAGCACCGAAGTTTGACGACTTTAT
AACCACGAGATGCAAAGGATCGTCGAAGTCCGCAGTAGCTCGCACCTTGGGCCTCTCATTCCAGGGCTGTCCCGCCAGCGAAACGCCGGCAGTGCTGATG
CTTTAACGCATGACAATCTGCCCCGACAGCCAGGCTTGGTCCTGAAGAATACGAGGCGAAACTCGCGTGATTGCGCTGCGTCAGCGCTTATGTTACTCGA
CAGGCTCCGAGTCTCAAACAGGCCTGCCG