Description :
From Genome Similarity Track
Location :
Scaffold_115:22537- 23963
Sequence
1426 bases(100 bases per row)
ACGCAACGGGTTGCTGTATTGTACAGCCGTTACCGGCGACACACCTCGTGTCGTCGTCCCCACTCATAATGCTTCGCTCTTACGCATCATGTATAAGTGT
CACGATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGACTTTTACTGGCCCGCCAGTATCAGTTCGTGCGGAAGTA
CATTTTTGCTTGTGAATTGTGCCAACGGGTGAAGCCCAGTCCTTCATCCCGTACACCACTACAGCCTCTATCAATTTTGGCAGAGTGCTGGTAGTCCGTT
TCAATGGACTTCGTCTTCGGTTTCCCCGAAGACGCTCACAAGAATAATGGTCTTCTCGTGTTCGTAGACCAATTCAGCTAGATGGTACATCTTGCTGCAG
TTAATGAGTCAACCTCAGCACATGGTTGTGCCCGTGCCTTCATTGACACGGTAATTCCGACTCCACGGTCTATCCCGTTAACTATTCTCTGATAGCGATC
CTCGGTTTACGGCGGCGTTTTAGCAATCCGTGTTCCGATCCCTCGGAACACGTCTGACTATGCCTACTTCTGACCATCCCGAGACTGATGGTCAGACAGA
ACGCGTCAACCGCGTCTTCGAAGAGATACATCGAGGATACGTCCAATCTTACACAGATTGGAGCGAATTTTGCCGATGGTGGAGTTTGCAATCAACAACT
CCGTGCATGCATCGACAACACATACACCATTCTTGGTGAATGTCTTACGCCATCCACGCCTACCCACCCATTTAGAGTGTGATACTAATTCAAGGGGGAA
GGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTTACTCATCACGTGTCGAGGTAACTGACGACGCGAACGTTGTCGATGTCGATCAAATCGACATCGAAG
CTGATGATCTCAGCAATAGTGATGACACTATTGCTGATCCAGATGAGGGTGACGATGCTGGTTTATTTAGCATCGCCTATGACTTACACCAGCGAGGGAG
AGAACACCCTCGCTGGAAAAGATGATGATCTCCTAGTGGTGCGCAGAAGGCGCACTGAAACAAATTAAAGTGATGCAGCAGAAGATTTCCTGCTGGCACG
AGAAGCAGTGGTCCGTTTCGTGCAAGACTCCATCGCTAACGCGGTAGAACGGCTGAAACGGAACGCTGAAAAACATGGAATAGAAAACGTTCGTCTATTT
TAATGTCGGAGACTTAGTTCAACTGTCTACAGTAAATCTACCCTAGCACGTAGTAACTACTGTGGGTATTAGTAAACTACTACTCAAGTACATAGAACCG
TTCCATGTACTTCATCGCAAAGGCAATGCGTCACGATCTAGTTGCCTCGCAGGATGCGTACGCATCCTACGTTTATGTCGGTCGTCTCCGCCCGTACCAT
CACTACGAGGTCTCTTTCTCGGATGA