Description :
From Genome Similarity Track
Location :
Scaffold_23:225351- 230175
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10795hypothetical protein

Sequence
4824 bases(100 bases per row)
CGGTCGTCTGAGGGTGGCCAGCTTATTCTCCACGCGCGTTTGAATGTTAGCTAAGCGGATTCATCATGTCATTTAGCGTAGTGGGCATTTCTCAGAAGAT
ATGAGAAAAGTTTGTTCACATGTTTAAACGAATACATCAGATTATGTGGTCATGCGTCGTGATATAGCATATCCAAGTAGAGTCGAGTTGATACCGTAAA
TCACGGCAAACATGCAAAGTAGAAACATAGTCAAAACCTAAAAAGCTCTCGTGGTCGTAAAAAGACAACCAACTACAGACGATCCCCTCGGTAGTCATAG
CGTTGGTAGACCCGAATTTATTCATGTCTAAAGGTATTTCTGTCCTCGAATGTACCACAAAATGGATCCGACTACCTTCAGTTTGGAATGTAGCTCGTTA
CTGGCGATTTACCCTGTTTTGCTCTTCTATTGCCAGTTTTGCCTCACCACACAAATATATCCTCCTCTCTAGCCCGGCCAGTCCATCTCACACTCACCAA
CACTCAACGACTGCTGTACAAATATGTTAGCACCATGCTCACATACCTAGTTTGTCCCAGAGCTAAATTCATAGGCTCAAAGAATCTACGGTCTTGGAAA
CTATTGATACGCTGAACAGCACTGGACTCACTTCCGGTCTCGCAGTTGGCCACCAAATCGCGGCACGAGGCGTGCGCCAGTTTACACCCGACCAGGTACT
TGCCAATTGTATTTCGTGGGGCGAAGACTCTTCAGAAGAGGGTGTTGTCGTCACAGGTGTGCAAATTGGAGTGAATGTTGAGCATTTCTCCGTGGTCCTA
AAGTTCGAATCACGTCCAAAGTAGTCTAAATAGGCTTTCATCGGTTCAACATTCGGATCTGACGTGGCAGCAATAATGCTCTTGTATAGTTATGACTTTA
CCATAGTTAAGCACCCCAGAATAAGAATATTTGACTTCAAATTTATTCCATTTTACTTTTGAGGGGTGAGAGGGAATAATATCTTGGGTTTGTAAGGGAC
TGGTCAACAGGAACCGCTAATTTATTGCTACTGGGGGAGTATTCCAAGTCTTTGTTGATTGGTACAGCCACACTAACTTGATGGTTTTCAACTCAAAATC
GACTTTGAGCTTCCACGGTAGGTTTTAACAGGCCCCCCGCTTAGACCGACAGCGAACCTCTGGACATCTTGGATCCCGAAAAGGAACGAGGAGCTCTCGC
GACATTTTTTTATAGAAAAATATGTCTTTCCTTAACAGAGGTACTTCTCGCCCGCTTCAAAATGACGTTTATATATATATTTGCCGATAACTTTGAAGCC
TGACCTCGGCAGAAAGCGGTAAGCACACCATTGAAAAGCCCCCGGTTTAGCGCACCTGAGCATATTTTTTTTGTTGCACTAGAAACTGGTACGGATGAGC
ACCATGCGCTCAAACTCTCCGCAGTTTGAATCCCATTAGTTTTTTTGACGCAGTTCAGTCAATATTTAGGGATAGTACACCTAATTTTAAGGACGATTTA
AATTAGACGATTAGCTTCCATAGAATGTGCCCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAGGTCT
TACCCATCACGTATGGTAAATTTATAATATCTTCGGCTAGTGTTTGCAAAACACACCACTCAGCGAAAGCATTTAGCGACAATTCATTTTTTTTTTTTTT
TAGGATTTTGGGACTTAAGCTTTTACTGCTCAACAAACAATTTATTTTTTGTGTAACTCGGGTAATCTATTTGAAGCACCAAAATTTGCTACACTTAACC
AAAATCTGGCTGAATATCAAAACTAGTCTTGATTAAAAATGTAGCATGTATTGAAGCTACTGAAGCAGCTAGTGCAGATCAGCTACTCCTCGACAAACTG
CTGCTTTCTCCACAACAGCGATAGCCTTATATAGATACCGCATTCGTAGATATGGTTGTAACTGATAAAGGCAGTCGCCCCAAGTCGCATTTGTAATCAG
CATCTCCAATATAGCTAGGCACCACACTCCACAAGACGTTGCATCTCGTTGTTTACGCACCTCGACTTTCTCAAACGAAACGTCATGATCCAAACCTAGG
ATAGGTGCGACCACATATCACACACTTCCCCCAGTGTCATGTAATTGATGCTTGATTGAAGAGAACCAAATGTCTTACAAAACATTTCGTTTTTGTCAAC
GTAGAAGGCCACTCAGTGTAAACCGACATTCATGACTCCAATGACCCGTGTATACTCACGGTTTTCTGCCCGGAGATCAGCTGCGACGCGTCGGTTTTGC
TCCAGTACATAAAACTCGTGGAAAGAGGGGCTGATAATACCAATGGCAGGATATTCGTCTCGAAGTGTCAACAAAGACACCTGAACAGAGGTGGTGTGCA
GCCACAACTCATCTCTGAAGTAAAAAATCTTGTGCCCTTCCAGCACATCACCAGGTACACGCATAGTTCCAAGAGTGAGGGTCTCGACGTAGCCCTTGTA
ATGAGACTACACAACAAATAAAGAGTTCCTATTTTGGTAAAAGATAGTAACGTTTTGGTAGCAATTTGGTGTTTTACCTTGGTGACAGCTCGGGTGTCGT
CAAAAGGTGTCCGTAGATTCTTCACGCGCCACTCCGCTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN