Description :
From Genome Similarity Track
Location :
Scaffold_170:22535- 26522
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_170-snap-gene-0.20Serine/threonine-protein phosphatase
Pytul_var.sporangiiferummaker-pug3_contig_170-snap-gene-0.21GG19381
Pytul_var.sporangiiferummaker-pug3_contig_170-fgenesh-gene-0.15Vacuolar protein-sorting protein

Sequence
3987 bases(100 bases per row)
AAGCGCATTACGGCCCAGGTTGTTTCCTGTCGCAATGCAAGGCTCGTTTCGGCAACGAAGAGGGCTATATCGTCTGGCATCAGGTTAATCATGCTTTCGA
TCGATTACCTCTCGCTGCAGCAATTGATAACGACATCTTCTGCGTACATGGAGGAATACCAAGATCAGTTGGGAATGAGAAGATTCTTGACTCAATTCAC
AAAATCCCATCGAAAGCCTTGCTCGACGTTCTTGACATGAAATACTATGAAGAGAACTCGCAAATATCAATGGTGTCAGATATGCTATGGGGAGATCCAG
TGCTTGAAGAAATGGAGTCTTCATTGGACGGCAAAGGCTTTGGAAAAAGCGTGCGCGGTGGCGTTGCTGTCAGCTTCGGTGAGAAAGCCATCGAGAATTT
CTTGCAGCAAAGCAAATTTTCCCGAATTTTGCGTGCCCATGAAGCCAAGGTTGACGGCGTGGCAGTGAGTAAGAGTGCCCGCATCATAACAGTTTTTTCG
ACATCGAAAGACCATGGGCTCGGAGAAGATGCGAAATGTGGCTGCCTTTTGATCGACAATGGGAAAATCATTTCCATTAATCAGTCGCCTCAAGCTGCAA
AAAATCTGCAATTGTCGCGACGGAGAAGTACAAGCTATCAAAGCGATCTGCGCTTGCCTGTTATGCCTCCGGCGCTACAATTCGGAAGTGGTGGAAACGC
GACGGGTGCTCCAGGTAGCTACTGCACGATTGCTTCTTGTAACGTACCTTCGTCTGCTGCTCAGCATGAAGAAGAGAGAGCGGTTGAAGCTGTTCAGCTC
CCACTGAGTGACACTGCGATCAATCATGACGACGGGTCGGATTCGACAGACGACGAGGAAGATCCACCGCCACCACCGATGCGTCATCCAAGTGCTCGTA
GTCCCTCGCGATCGACCCCGTCGACAGTCGATACGACTACACAGAGAGGAACGGTGCAGGATGGAATGCGTTCACGGCTTACGCTCAGGATCCCTTCCAA
TGTGGTGTCCACCGCTTCGCCCGCCTCGTTCACTTCTCATCGAACTGAGAATGACGATGACGAAGAGGACAATAACCAACACGATGACATTTAAATTTAG
TTGCATGCGCTCAATATCCCAAGAAGTGACGAAGTCGGTAGCTAGGATCCAAGTTCAAGAATGCAATGGCAGGAGCATCATGGATTCAAGACACACTGTG
CACGTAAGCTAAACAAGCACATTTTCGCATCATGTACAGGGTCATGCAAAGGGATTAACGTTGAGAAGGCATGCAGAAGAGCCCTCCATGACGACACCAC
ACATAAAGCAGCAGGAATCTTCCAGAGCCACACACACGCACGTGCGAAGGTAAAAGCAGCCATGATCGTTCAGAACCCTACACCATCACCCACGAAACGC
AGGATGAGCCAATCGTTTCGTTTGCGACGCGTCCCCCAGCAGTTATCTCAGGATATGTAGTCACAGGAATCCTAGACGACAAGAGAAAAGATCTGCTGCA
TTGCAATTCTGAAGATCACTTTCAAGAGGATATCGATTTACAAGTGAACGACGGGCCATCCGTGGGTTGATTGATTGGTGGAGGAGCTTTATTTGAGGGA
GGGGGTTAAAAAACACAATTGCAGCGGCACACGAGACGCAGCAGTCCATTCGCGGAAAGTAGAGCAACCCACAGAAGAGAAGCCCGACCGACACGATGGC
GCCTCGCGTGAAGAAAGACCGCAAGGAGAAGAAGGTCTCCAAGAAGGCTGCGGCCGAGGAGAAGAAGAAGGCTGAGACCGAAGCTGCACTCAGCAACATG
ACGCTCGCCGACCGTCTCGCTGAAGAGGGCATTATCGCGACCTGTTCGCACAACGTGCGCTCGGTGCACAAGAACTTTAAGGATATCAACGTGCTTAACT
TCTCGATCACGTACTTCGGCAAGGTGCTGATGGAGGAGTGTGATATCTCGTTGAACTACGGCCGTCGTTACGGTCTCATTGGTCGCAACGGTTCGGGTAA
GTCGACGTTCATGAACGTGCTCGGTGCCCGTGGTATCCCGATCCCAGACAGCATCGATATCTACCACTTGAAGCATGAAATCGAAGCCAGCGACATGACT
GCGTTGGAAGCTGTGCTTTCCGTCGATGAAGAACGTGCCAAAATCCAGGCCGAAGTCGATGAGTTGTCAGAGAAGATGGGTGATGAGAGCATGAGCGAAG
AAGAAAGCGAAGCCGTCTCGGAGCGATTGACCGACCTTTACGAACGTCTTGATGAGATGGACGCTGATACGGCTGAACTTCGTGCGCGTAACATTCTGGC
TGGTTTGACGTTTAGCGACGAGATGATGAAGAAGAAGACCCGTGAGTTTTCTGGTGGTTGGCGTATGCGTATCGCGCTTGCGCGTGCGCTTTTCATCCAG
CCAACGTTGCTGCTGTTGGATGAACCGACGAACCACTTGGNNNNNNNNNNAAGCCGTCGTGTGGCTTGAAGACTACTTGTCGCGCTGGAACAAGATCTTG
CTCATGATTTCCCACTCGCAGGAGTTCATGAACGAAGTGTGTACCAACATTATTGACTTGACGGGCAAGAAGCTTGTGTACTACGCTGGTAACTACGATA
CGTACGTCAAGACCAAGGCCGAAAAGGAAGAGAACCAGATGAAGAAGTATAACTGGGAACAAGACCAAATCAAGCACATGAAGGACTACATTGCCCGTTT
CGGTCACGGTTCCGCCAAGTTGGCTCGTCAAGCTCAGAGTAAGGAAAAGACCCTGGAGAAGATGGTGCGTGAAGGTCTGACTGAGAAGGTTGTCCACGAA
GCGATCGGTGACTTCAAGTTCCCAAACCCAGAGCCTCTTCCACCACCAGTGCTCATGTTCCAAGGTGTGGCGTTCGGTTACCCAGGCTCGCCATTGTTGT
ACGAAAACGTGGAATTGGGTCTCGATTTGGACTCGCGTGTCGCGCTTGTCGGTGCCAACGGTACCGGTAAGACCACGTTGCTCAAGTTGATCACTGGTGA
TATCTCGGCCGTCAAGGGTAGCGTGCGTCCTCACAGCAAGCTGCGTATCGCTCGTTTCTCGCAGCACTTCGTCGATGTGCTTGACTTGAACCAAGCTCCA
TTGGAATACTTCCGCTCGTTGTTCCCAGGCAAGTCGGTCGAAGATGTGCGTAGTTACTTGGGTCGTTACGGTATTTCGGGTGAAGTGCAGACACAAATCA
TGGGTCAATTGTCGGATGGCCAGAAATCTCGTGTCGTGTTCGCGTACATGGCGCAGCAAAACGCTCACATGCTGTTGTTGGATGAACCTACGAACCACTT
GGATATGGAATCGATTGATGCGTTGGCGCGTGCGATCAATGAGTTCAAGGGTGGCATGCTCTTGGTGAGTCACGACATGCGTTTGATCTCGCAGGTCGCG
AAGGAGATCTGGATTGTCGAGAACCAGCGTATCCGCGTGTACGAAGGTGAGATCAGCGATTTCAAGATGGCGGTGCGAAAGCAGTTGAAGTTGGGCGACA
AATAAGCGCCTTCCAATGTGAAATAGGAATCGTCCATGTAGGTGCTTCCTCCTTTTGCGGACAACTTTTAACTTTTAAGCAGCTACAGAAAAAAACACAC
ACATACATACCAGGATACGGGGCTCCGAGGGCTCTTTTAATATAGATTTGTGAAATTGGGTTTGAGCAAACACCATCGCGCTTTGTGAGCAACCTATTTT
TGCTTGTATTTGTCATATACACGTCGTCCAAGCTACAAAAAGGTAGGTTGACGAGAACGGGAGTACAACTAGGAAACAGGAAGGCTATGACGCAATCGGG
AGGCCAAACTCGTCGGTTCGTCGCCCATTTCGAGCGCCGTCGAGCACCCCAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCTTCGGCCCATTCCTCTTCGAGACCGGCCAACTCGGCTTCTAGTTCGC