Description :
From Genome Similarity Track
Location :
Scaffold_609:22532- 24960
Transcript NameFunction/comments
Phyta_totarag9631hypothetical protein

Sequence
2428 bases(100 bases per row)
AGGCACTACACAGCTCGTACGTGAGTTTGTCTCAAGCCATCGGCACCTTTCAATCTTGACGAGCTCTCGGTCATTGTGAAAaacaccttcttcagcacca
gTCCACGATGTCTGCCAATTAAAAAGCCCCGCGTTCGATAAGGCAGATCCGCACCCTTTGTTGCGAGAATTTTTTTTCCGCTTCCAGCATTGACATGCAC
GATTGGCATCTTCTATCATGCTTCAAGTTAGAGATATTTTGGTTGTACACAATCTGTAAGGGAACGGGCCcggtggaccatgatcgtatcaagtacgaca
ggatatatcgttagacaagttcATCTTAGGCCGGTTCATCTGTACCAATAAAATACATGGGGTAGAAACAACGTGAAGacaggtaccggtaccggtgTGT
AAGTGACATCTTCCTACACATAAGAGCCGGAAATCGCAGTGTTTCTACAGATGTGTCTTTTTACAagaattacatgtacagtactggCATCCTGCCTCAG
ATTGAGGATCTCAGTTTTATTGGCCAACGCTGCATTCTTGTGATTTGTGGGGTTCAAAGGGCCCCTTTGACAAAGGAATTTCGATAATACAGTTGTGTAC
TCCTTTTCGGCATCCATATTAACCATTACTCTTGAATATTTAAGAGAATGGCAGAATCGCACAAACGAAATAGGGAAATTTACAGAACGGAAGGGGTAAT
CGCACAGATAGTAACGGTTCTACATAGGGTCTTCTATTGAGAGAATACTGGGAATTGCACCCCCAGACCCCCGCATTAGAAAAACTAACTCCGGGTTGCG
GCAATGGGTCcgttcgctggaatgctcgtcgctgggcccgcctacgcaaataccgcgcggccctgcttcgcgggcaccCCGCTCGGGTTTGCTACGGCTA
GCAACCACTCACTATCGTCCACTACTAAGAGCATACTTCTTCACAATCTGTGGATTTCACTTTTTCGTCTGTGCGATTAACCTTATCTCAATATTTAAGA
CTACAACCCATTCCGAATTTTGTAAGCCAACTTGCCTTCTAATAAACTATCACCTGCCACATTTAATGTGGTCCACCTGCCGAAAATGAGATGCATACCG
GTAACTGTACGGCAAATACCCGAAGGGCGGACGAAAATATACCTAAAAAGCTACGAGAGTCAGCCTATTTACCCTAACCTGATTACTACTGCCTCAAATT
TTGAAAACGTTATGGGCGAGTTCTCGACAATATGAACCGCAACCTGATGGCGAGTGCTCGCAGTGTGTGGAATATTGCTGCACTATGAGACTTCTCGTGA
ACTGTGTGGGCTCACAGTCGGGATACAATGTAATGCCCGCACTTAACTTTAACTTATTAATTCCGTGGTACCAGCCTGGTACAAGGTATACGGTTATCGA
TTATCGTACGATCTGTAATAGACAGAAACGAGTCCGTTCCGTGTACTAGTACAAGtatcggtacatgtagtagtacTGTACTACTGGTACATGAGTATAC
TGGGTATCGTGTTGTCGCTGTTTTACAGACTGCCCTCGCACTGCGTGTCGCAGATAGCTTTGGGCTTAGTTGTTGCGGGTTGTAATTCAGGTTGGCCGGC
AGGCCCATCTAGTGTAATAGTTGATGAGCCATAGGTCATTTTTCAATTTGACGTGTAATGAACAAACACTACAAATTCAGCAGTGGGACTTGACACACAA
GATCAGCCATGCGTCTACTGTTTTGGATCCTCTTCGTAGCCTTGACGACCCTGCTTTCAACCAACGAAGCTATCCCGGTCATCCTCAAGTTGGACAAGAG
CAAGATACTCGACGCCATTGCAGACAGCAAGGTGGTACCTCGTGCGCAAGAAGCCCAGCACAGTGTCAGTCAGCGACTTCTGTGCAGtgacgacaagaac
gacgcgAACAACATCGGAGACAATTCCGTGGATGAAGAGAGAGTCATGGCTCTGTCCGGAGTCAcgaacttcttcaccaaAATAAAGCACAGTGTCGGCA
AACTAAACCAGAAATGGCAGAACGACAAGAATTTGCGCAAGATGAATGACATGTTCACAAATGGAATGACCCCTGAAAAACTGGAGGTACTTTACGGAGC
GACCAAAAAGGTCAAACTACAAGAGGATTTCAAGCAGTTCTACAAGTGGAGATCAAGCTGGCAGCATCAGAAGCCTTACCCTCTGCCCAAGAAAGTTAAC
CCATGACCTTCATAAGAAGCTACGGAAGTTAAGCAAACTGTCTAATACATCCATTGTATTGACAAGTATTGAAATATTCGATTGCGAGCCACATCACGAC
ATTGATACCACTATTTTTCAATCCATCAACCCGTGAACACGTTGGGGCAAAAGGCGGTCGTTCTTGATTACCGAAGGCATGCTCGCTGAGGGTTTCGAAG
ACTCGATGCAATAAACAAACTGGCCCGA