Description :
From Genome Similarity Track
Location :
contig_9:225316- 230023
Transcript NameFunction/comments
g2243.t1hypothetical protein

Sequence
4707 bases(100 bases per row)
GTCCACAAACCGATTATACCGACATCCTCGCCATCAAGTTCAATGCATGTATCTCAAGTGCTGTTAGCAGCTACTGTTACACTCTTCGCACTAGTGCCGA
TGTCGCCACCGCCAGTGACGCTGCCGTAGCTGCAAAGACCAAGTCTTCAGCAGTTACAAACGAATCCCTGAGCTTTTCGTGAAGAAAATTCCGTTCAAGT
ATGGCAACGTTACTGGCACGATGGTGATCACGATCGACCCGGACAGTCTGCGCGAGGCTGACGATGACTCTGCCTCCACCGACGCATCAAAGGTGTACGA
CTTCACCCAGTCTGACGAATCTGGATCGGACGCAGAAGAGAGAGCGCTGTTTGGGAGCAAGTTTATGGAGTCGCTTGTGCTAGGATTTAACGGTTGGCGC
AATATGTGGACTAGGTTCAAACTGGGGTAAAGTGATTCGTACTACTACTAGTATCACGCAAATGCCTGTAACCGGCTACAGTAGTTTTCGTTGGCTGTAG
TCTACTGCATCTACTGTGTTGAAAAAAGTAATTGTCCCCACCCAGATCGGTTGGCCGCTACGTAAGTACTTCTCTGGTGATGTGCAGTTGGCATTCACTG
CATCTCCAGACTCTTCAGTCAATAGCCTCCTTCAGTAAGATCGGCTGATAGTGTTTCTCCAAGCAATTTTCACAGCGTCCAGAGCATCCTCTTGATCTGT
CTGCAAACGTTTCACTGTTGATGTAGATGCGAGCAAGAAACTCTGTAGGTACAAACTTGTAGGCTAGGTTGGGTTGCAGCGTCCAGGAAGAGAGACATCG
GGAACAGATCGAAATCGAGCAAACAGCAGCTTTACTTCAAGCAAAGGCGACACCATTGGCACTTGGAATAAAATCACGCAAGGTTGGTGATTCGACTTTA
AAATTGAGGTCACCGGTCGTTCATTTGAGATCGAGACCCTGGATAATGCTCGCAGATCCAAGCCTGAATTTCGGGTGTTTGGTTGTCGAAGATGCCATCT
AAGTCTTCCTCAGTGAACTTTGCGTGAAGTTCGTGGTACAAAAACAGCAATACTTCGAACTGGTCGGACATTGCGGCAGCATCAATACCTTTAGAGGGAA
AAAAAACATTCTGTTCGATGCACAGACAACCAGCGAACAACATCAAGAGACCTACCACTAGCAGCATTGATCATGCTCGCTGCGTGCACCCTCGACCCGA
TTCTGATGTACCATTCTACAATCCCCAAAATGCCGTTCTTAGCAGCTCCGTCCATTGCATCCGGTGTACACCCCTCTGACCTGTTCAAATGCAACCATTG
CATTACGCCAAAATGCCCGAAATTGGCAACTTGGTCGAATGCTTTGGTCGTACTACCAGCGCTGGTGTTTTCATGGAGCCACTTTACCAGTTTCAGAGAG
TCATGCTCTGCCGCACCATCCATCGCTGCTCCCGTTGCTACTGCCGTGCATCCTTCGAAGCGGTGCTCATGAAGCCACCGGGCTATCTGTAACTTACCAC
GTCTTGCCGCAGCATCCACTGCACTCGTTGTACAGCCTTCCTTTCTGTTGTAAGGAAATGCCACTTTACAACTTGCAGGTAACCATGCTCAGCTATCAGA
TGCATTGCTGCCGTCGTGCTTTTTGGACTGGATCCCTTTTCGCAATCATTTCATTTACCCTTCGTTTAAATCAAAATATGTAGTTGATTCGGATATTTCA
TCACATCAAGATGTCCACTGCTTGCAGCCGCATCCATCGCGATCGAAATATCTCACATGTTCGCTTCACCATAGCCAAACAAGTCAGTATGAAGATCTTC
GCCGTAGTCTGCGTACAACCATTGAACCACGTCGAGACGACCCTTCTCGCTGCATCCGCCATCGTTTTCCCTGGTACTATTCCAGAATTGTCGTAGTAAC
TGAGGTACATAGACAATTTTGGAGGCTCCGACGTTGTTTTGCCTGCTCCACTGCGCGCTGTAAGCTGTCCGTCGGCTTTTCGTGCGTGCTCGAAGATACT
TTGCAACTTCTAATGGCCTGCCACTGCAGCACTATGAATGAAGAGGCTAATTTCCCCACCCTAGTCAGTGAGATATGTACCGCCACTCTTTCGTGTATCG
CGATTGATCACTCATTGGACAACATCGAGTTCTCCTTTATCTGCAGCTATCACCACCAGTCCAATAAGCCCCTCCACGTGACCTTGCTTCGCCAGCCATT
TGAGCACATCGATACGTCCTTGAGCTGCCGCAGAGTGCGCCAATTGCAGGCCTTGTGTATTTCTCGGCCATCTTGCACCTTGCTGGAGTAACCAATCAGC
CAATGGCACGGCACCATTATTCACTGCAATCTGCAGAGATCTGTCTTTGTCGTGACTTTCATCTGAAAAGTGCTCAAGCAACCACCACACGACGTCACTA
CGCCGACTTGACGCTGCGTCAGAGAGATTTTTCTCGCTCCACTGAACACGAATACCCACGTCTGTAGCTTGAACACTTGGATTCACTGAACTATTGCCAC
TTTCAAGCAAAGACTTCAGCAACGGGATGGACCCCGTTGCAACTGCTTGACTCACAGTATTTCAGCACCATGCAGCCTTGGAACCTAGAAGCGAGCCACT
TGACCATCTCTAGATTGTGTAGGCGAATAGCTTCCCCAGCGACAGTGAGAACTGATACTGTCGGTAGTATTTATCCGTGCGAACAAGTCTCCGTAACGTC
CAGGAGAGTTGCGCCATATTCTCGTTGCGAACGGTGAAAATCTCGCTGCTGGCCCAAATCCGACTCAGCAGCTGGATTGAATTCCGCTTGCACGCCTCGT
TCAGAGGAGTTCCATCGCAGAGTCCAGGGTAGTAGAGACTGCAGCCACAACGTGGGGAAGGTTCAAGAACTCGCCCTTGGCGCGGAACAGCAGCTTCACG
ACAATGAGCAGCTGGTCCTACGAGTTCATCTCGACTTTTTCTGGCAGGATTGATTGTTGGCAAAATATGTGTGTCGCACACCAATCGAATCCATACATAT
TTCAAATGCATTCGTAGAGGAAGTAACTTTGTGCAATTGTTTCATGAAAACGATAGCTCGTACGGCACTATGATAGTGACTCATCAACCACTTGGGATCT
CAGACATCCGAAGCTCATCTGTTCCCAGCTCGATCGCGCAGCCTTCGTCTCTTATTTTGTACAATAGCAACACGATCTCGAAATGCCTGCAGCGTTTCCT
ACTGCTGGGTGTCCAGCCTTCGGAACGGTTCTCATTGATCAAAGGCAGCTCGATTTCAATCTTAATAATAGTCGATGGTTGCATTTACTCAATGTTGACT
ACGCTCAAAGATCCAACCGTTTTAGGGAGAGCAAAGTCGAATTTGAAATTCAAGATGACATTGCTCATCACTTGTCGTACAACTTTCGCTGGTCGTGCAG
CCATCTGAACTCTTGGCCAGCTTATCAATAATACCAAGACCTGTATTCGGGGTACCGCTCAAGAAGCCATCTACGAACGCCTGAGTCCGCCACACCTCGC
AAGGCGGTGAACTTCCTCGCTTTATCTTGTCCAGTAGTGCCAAGCATTCAAACTCGGACCTTTGAAGTGCCTGGTCCATCCTGCTACTGAGTACCATTCG
TCGCGATTGTCATACAACCACCGAACAACGCGAAGATGGCCGTTCCCAGCAGCGCCGTCCATCGCTGCTGTCGTGCAGCCCTCACTGCGGGTATGATGCA
GCCACCTTACAACATCAAGTGCCCCGCAAGCAGCGGCGCCGTCCATTGCAGCAGTCGTACAACCTTCAGACTTGTTGCAGTGGAGCCACAGTACGACATC
AAGATGCCCATTGCTAGCTGCTCCATCCATTGCCGCCGCAGTACATCCTTCCGTTCTGTGACCGTGCAACCATTTCACTAGATCCAGATGGCCGTTAGTC
GCCGCTCCGTCCATTGCCTTCGGAGTGCATCCTTCTCCGCGATGTTGGTGGAGCCACTGCACCACGTTCAAGTGACCATTTCGTGCAGCATAGTCCATGG
CGTCTGTAGTACAGCCCTCCGTCCGGTTATGGTGAAGCCACCGAACGACGTCTAGGTGGCCATGGGCTGCAGCGAGATCCATTGCTGCCACCGTGCAGGT
TGGCGTCCCTGGTGGGGAAGGCCCCAATGGCTGTGCAGAGCTGGAACCTGGATCTCATGGCAGCACAGTTCTGGGAACTTGAGCAGCCGTCTGCGTTTCA
GGTTGCGGGTGTCTTCGAGGACTGGATCTTGGCCAATTTGATGCAGGAACTGAACAATCGCCAAGTGCCCAGTAGCAGCAGCTGCGTCAAGTGCACAATC
GTACCTCGATTGCTCGTTTGTGCACGCAGACAAGAGATTCATCGTTGGGTCATCACCAAATTCTGCCCATAGCCACTGGACAACATCGAGAAACCTCGCT
CCGCAGCAAGCACCATCGTATCTCTTGAGACTGTTGATAAATTGGTTTCAGATCTAAGTTCCAATTTTTTCAACACCTTCATCCAGGTGTTCGGACCTCT
GCCGCCTTGCACTTTGTCGTCAAAATCAAGTCGAATGTCGATGCGATCGTAGAGGTACTTCGCAACGTCCAGGTGTCCATTCACTGCAGCAGCGTGAATG
GCAAGCCCCGCTTCCCAACCGAGGCGGGTAATTTCAACGCGTCCCTATTTGAATCGGATCTCAGAGCGAATCCGCAGTCCCCCCAATCACGGTAATTGCG
ATCTTGT